Previous Article | Next Article ![]()
Molecular and Cellular Biology, May 2005, p. 3608-3619, Vol. 25, No. 9
0270-7306/05/$08.00+0 doi:10.1128/MCB.25.9.3608-3619.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Laboratory of Vertebrate Embryology, Rockefeller University, New York, New York
Received 26 July 2004/ Accepted 12 October 2004
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Phospholipases A2 (PLA2s) are enzymes that catalyze the hydrolysis of glycerophospholipids to yield fatty acids and lysophospholipids and are considered key enzymes in the generation of biologically active lipids during inflammation (46, 54, 58). Within the PLA2 superfamily, two main classes of enzymes have been identified based on their subcellular distribution (54, 58): the cytosolic PLA2s (46) and a large number of molecules that are released into the extracellular space and are therefore termed the secreted PLA2s (sPLA2s) (8, 9, 14, 56, 58). These secreted molecules are Ca2+-dependent phospholipases, disulfide-rich proteins of 14 to 18 kDa. Current evidence suggests that the biology of the sPLA2s is complex, both in the types of responses they elicit as well as in their mechanism of action. It has been postulated that the biological activity of this class of secreted proteins might involve receptor-activation and signaling in a fashion independent of their enzymatic activity (14). Two biochemically distinct classes of receptors (M and N types [2, 9, 48]) and a variety of extracellular binding proteins have been identified (58), suggesting that the sPLA2s might signal through receptor activation. However, there is no conclusive evidence that the bioactivities of the sPLA2s might arise from two distinct mechanisms, one mediated through lipid hydrolysis and one mediated through direct activation of a receptor.
Recently, a novel sPLA2 has been characterized as an independent class within the sPLA2s (14). This molecule, termed sPLA2-gXII (for group XII), is a highly conserved protein that retains the active-site histidine and the histidine and aspartic acid catalytic dyad found in other sPLA2s (see Fig. 2) (45). Although this protein retains weak lipid hydrolyase activity (14), both the pattern of cysteines outside the active site and the Ca2+-binding loop are quite distinct from other sPLA2s. Furthermore, the unique distribution of human sPLA2-gXII suggests that it might fulfill specific functions (14). As part of a gain-of-function screen aimed at identifying factors with embryological activities during Xenopus laevis development, we discovered that sPLA2-gXII modulates germ layer specification. Overexpression of mouse, Drosophila melanogaster, and Xenopus orthologs of sPLA2-gXII in the prospective neural territory leads to ectopic neurogenesis and to the induction of ectopic olfactory sensory structures, including olfactory bulb and sensory epithelium. Because of the effects of sPLA2-gXII on ectopic olfactory generation, we renamed sPLA2-gXII "Rossy" (after Pedro Almodovar's actress Rossy de Palma, most likely the "most famous nose in Spain").
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Embryonic expression of xRossy. Expression of xRossy by in situ hybridization with xRossy digoxigenin riboprobes was performed as described previously (16). Reverse transcription (RT)-PCR analysis of xRossy was performed with 5'-GACTGTGATGAGGAGTTTCAG-3' (forward) and 5'-CTCCAGGTAAGGTTTACATCC-3' (reverse).
Embryo manipulations and RNA injections. Capped mRNAs were microinjected with (per embryo) xRossy (250 pg to 1 ng), bmp-4 (1 ng), Smad-1 (1 ng), Smad-4a (1 ng), and OAZ (100 pg).
Plasmids and constructs. Full-length Xenopus sPLA2-gXII open reading frame was amplified by PCR and subcloned into the pCS2++ vector. Drosophila sPLA2-gXII was subcloned into pCS2++ by PCR. The point mutant H113E version of mouse sPLA2-gXII was engineered by PCR with a QuickchangeM kit (Stratagene) following the manufacturer's instructions. C-terminal hemagglutinin (HA)-tagged mouse sPLA2-gXII was performed by conventional PCR.
Expression analysis of human Rossy in embryonic stem cells. Human H1 embryonic stem (ES) cells (WiCell, Wis.) were grown in feeder-free conditions as described previously (51). Primers for human Oct3/4 and glyceraldehyde-3 phosphate dehydrogenase were as described previously (52). Primers for human Rossy were (sense) GACGGATCTAAGCCTTTCCC and (antisense) CCACTGTTGTTTCACATGCC.
Luciferase reporter experiments. In animal cap experiments, embryos were injected with 25 pg to 50 pg of reporters together with various RNAs in one blastomere at the four-cell stage (BRE4-luciferase) or the dorsal marginal zone (ARE3-luciferase, TOP-FLASH, Goosecoid-luciferase, or Brachyury-luciferase). Assays were measured in triplicate, and embryos were lysed at stage 11 using the Promega luciferase reporter assay kit. In P19 cells, cells were transfected in 12 wells with reporters (150 ng/well) and renilla luciferase (3.5 ng/well), together with various cDNAs using Invitrogen Lipofectamine 2000 reagent. Cells were exposed to 10 ng/ml of recombinant BMP4 (rhBMP4) or activin proteins (R&D Systems) 18 h prior to luciferase measurements using the Promega dual luciferase kit.
Smad1 activity and oligonucleotide pulldown experiments. Smad1 phosphorylation in P19 cells was measured 30 min following exposure to rhBMP4 with a polyclonal antibody against phospho-Smad1 (Upstate Biotechnology). Anti-Smad antibodies were from Upstate Biotechnology. For the oligonucleotide pulldown experiments, we made 5'-biotinylated BRE oligonucleotides (from IT-DNA) encoding the wild type or a 3' box mutant BRE (19). Oligonucleotides were annealed to form double strands and incubated with the extracts as described previously (19).
Microarray analysis. Microarrays with 5,000 cDNAs from a gastrula stage library were performed as described previously (43). One nanogram of Rossy RNA was injected into the animal pole at the two-cell stage, and RNAs were harvested at stage 10.5. Results represent data obtained from four data points (two microarray experiments with inverse dye hybridizations). Primers used for RT-PCR are as follows (5' to 3'): clone 8-G4/Akt-like, (S) GTTTTTACAGAGGACAGAGCACG and (AS) CAAATAACCTCTCATGGTCTTGG; clone 22-A2/xSall1, (S) CAAACTCAATACTTCCCTCAACG and (AS) CTGGAAGAAGAGAATGATTTCCC; clone 29-E12/calreticulin, (S) AGTAAAAGCGATAAGTAACCGGC and (AS) AACAGGCACCCATTTATAGATCC; clone 34-A8/Bcl-7b, (S) TGGATTTATATTTCGGGCTAAGG and (AS) 5'-AAAGTTCTGCATGGCAGTATAGC.
| RESULTS |
|---|
|
|
|---|
|
Embryonic expression of Xenopus Rossy. In order to assess the embryonic expression and function of Rossy, we cloned Xenopus Rossy. This gene is conserved phylogenetically, and the open reading frame is composed of four exons, as identified in genomic database searches. The conservation between the frog and Drosophila cDNAs is considerably lower (26% identity), the homologies stretching to the active site and Ca2+-binding pocket (14) (Fig. 2A). Interestingly, the 14 cysteines are conserved evolutionarily, suggesting that structural conservation, rather than primary sequence, is critical for its function. Indeed, the Drosophila ortholog displays similar activities in all assays tested.
We determined Rossy's mRNA distribution by RT-PCR and whole-mount in situ hybridization. Transcripts are detected maternally and throughout early development (Fig. 2B). In the gastrulating embryo, xRossy is expressed in the ectoderm and animal pole, dorsal and ventral marginal zone mesendoderm, and, more weakly, the vegetal pole (Fig. 2C). This expression is corroborated by in situ hybridization during gastrula stages (Fig. 2D). xRossy is also expressed at neurula stages in the anterior neural plate (Fig. 2E to G), and it becomes restricted to cement and hatching glands, tissues known to be sensitive to BMP signaling (13, 22).
Neuralizing activity of Rossy in ectodermal explants. Although complex, the Rossy gain-of-function phenotypes can be associated with genes that modulate the BMP pathway. Because of the ectopic anterior neural structures, we investigated whether there is a molecular interaction between the activity of Rossy and this pathway. We analyzed cell fate changes in ectodermal explants injected with xRossy RNA. Indeed, xRossy induced, albeit weakly, Otx1/2 (a telencephalic marker), XAG (cement gland), and NRP-1 (pan-neural) and decreased epidermal keratin (not shown) without inducing mesendodermal genes. By these criteria, Rossy directly neuralizes the ectoderm, suggesting an inhibitory interaction between Rossy and BMP signaling. Next, and because Rossy acts as a weak neural inducer, we tested whether it could potentiate the effect of low doses of noggin (20 pg) in animal caps. Indeed, both the Drosophila and Xenopus orthologs can synergize with noggin, as judged by the expression of Sox-2, NCAM, and NRP-1 and of the anterior neural markers Otx1/2, Pax6, Six3, and Rx (Fig. 3A). Interestingly, we never detected expression of ventral markers such as Nkx2.1 or Shh, suggesting that the type of neural tissue induced by Rossy is dorsal. On their own, xRossy and Drosophila Rossy weakly induced xDll-3 (mDlx-5 ortholog), a gene required for the generation of olfactory structures (35). Overall, the effects of Rossy in the explants and in vivo suggested that its effects could be due to an interference with BMP signaling.
|
Induction of ectopic in vivo anterior neural marker expression by Rossy. The effects of Rossy on animal caps and in olfactory generation reflected a strong activity of Rossy on emerging neural tissue. Therefore, we monitored the expression of various neural markers in embryos injected with Rossy. The effects were more pronounced on dorsal anterior markers, where Rossy led to ectopic or expanded expression of Pax6, Rx, Six3, and Otx1/2 (Fig. 4 and not shown). The effects of Rossy led to a mediolateral expansion of anterior neural markers and N-tubulin (Fig. 4) as well as posterior expansion of the anterior markers Otx1/2 and Rx (Fig. 4C, D, G, and H). This occurred at the expense of cranial crest or placodal gene expression (not shown), consistent with the BMP inhibition model, whereby neural fates are promoted at the expense of peripheral fates (37, 42). The gain of Pax6 expression (a dorsal marker [53]) and loss of Xash1 (a ventral marker [not shown]) also confirm the specification of dorsal neural tissue formed by Rossy in the explants.
|
|
|
The effects of Rossy on the BMP promoters can arise from a change in the specificity of Smad1/4 complexes towards various binding partners and the choice of promoters and not necessarily on a direct transcriptional repression. In order to address at which step of the pathway Rossy acts, we monitored Smad1 phosphorylation, nuclear translocation, and DNA-binding activity in P19 cells (Fig. 7). We find that transfection of mRossy DNA does not affect Smad1 activation or the nuclear translocation of phosphorylated Smad1 (Fig. 7A to E). In order to monitor the binding of Smad complexes to DNA, we tested whether endogenous Smads bound a single BRE in oligonucleotide pulldown experiments (Fig. 7F) (19). In these experiments, BMP4 leads to binding of Smad1 and Smad4 to the BRE (Fig. 7F). Binding is abolished when extracts are incubated with a point mutant BRE (3' mut) (19). In the presence of Rossy, binding to the BRE is inhibited (Fig. 7F), as detected by the lack of interaction of Smad1 and Smad4 with the BRE. This suggests that the mechanism of inhibition of Rossy is due to an inability of activated Smad1/4 complexes to bind their cognate sites.
|
|
| DISCUSSION |
|---|
|
|
|---|
In our hands, Pax6 and Rx expression was upregulated in embryo and in neuralized explants by Rossy. The expression of Rossy in the hatching gland marks the dorsal-most region of anterior neural tissue and flanks the formation of the neurogenic placodes and telencephalon. Because of its effects on Pax6 and olfactory structures, it is likely that Rossy modulates the position and fate of the placodes and dorsoanterior regions of the neural tube. Although both Rx and Pax6 are required for eye formation (38), mice lacking these genes also show loss of the forebrain in Rx/ mice (39) and of olfactory structures in Pax6-deficient mice (24, 25). Although the molecules implicated in olfactory bulb specification are largely unknown, FGF signaling is required for bulb morphogenesis (21, 40). In addition, retinoic acid signaling from the frontonasal mesenchyme promotes olfactory bulb formation through Pax6 expression (1, 30). Therefore, the effects of Rossy could result from Pax6 upregulation, an effect on FGF signaling, or both.
In addition, the arrival of axonal projections from the olfactory epithelium has been postulated to play a key role in olfactory bulb evagination (15) through an effect on telencephalic proliferation. However, this has been recently challenged in mice deficient for fgfr1 in the telencephalon (21) and in Dlx-5-deficient mice (35). We observed the duplicated olfactory bulbs in the absence of duplicated sensory epithelia, suggesting that the initial evagination is independent of the olfactory nerve. In several embryos, we found ectopic olfactory sensory epithelial structures whose axons innervated the ectopic bulbs, even within the midbrain region. Given the modulatory role of Rossy on the BMP pathway, and the recent report that a BMP-related member, GDF-11, acts to inhibit olfactory neuron generation (65), it will be of interest to determine whether Rossy acts to regulate olfactory neurogenesis in mice through a negative effect on GDF-11. Although the effects of Rossy on olfactory generation cannot be explained exclusively through a negative regulation of the BMP pathway, the effects on xSall-1 in animal caps suggest that Pax6/Sall-1 overexpression might direct telencephalic cell fates towards an olfactory identity.
Modulation of BMP/TGFß pathways by Rossy. Overall, Rossy activity inhibits several BMP target genes. The finding that an extracellular factor can inhibit the intracellular signal transducers Smad1 and Smad4 suggests that Rossy likely activates a cascade whose input acts to block a subset of Smad-dependent responses. Our experiments in P19 cells have shown that this effect is likely mediated through the regulation of the DNA-binding activity of activated Smad1/4 complexes. In that regard, we postulate that the observed inhibition of known BMP target genes arises from a shift in target gene preference in Smad1/4 complexes, rather than in an inhibition of the BMP pathway per se.
Overall, our results suggest that Rossy might act in an instructive manner through the activation of receptors and transduction of a signal with the ability to modulate Smad signaling. Although two classes of receptors have been described, only the M type has been cloned. The N-type receptor consists of at least two subunits and is expressed in the nervous system (9, 56). Whether Rossy can bind to this receptor is presently unknown, although expression in P19 cells of the soluble version of the sPLA2 180-kDa M-type receptor (56) does not interfere with the activity of Rossy (not shown), suggesting that they do not bind in this assay. A previous report has suggested that mitogen-activated protein kinase activation results from the exposure of astrocytic cells to sPLA2-gIIA (23). However, we were unable to inhibit the activity of Rossy in animal caps with amounts of dominant-negative Ras that can effectively block mesoderm induction by bFGF (61). Interestingly, two of the genes identified in our microarrays, an Akt homolog and calreticulin, are implicated in calcium homeostasis. Therefore, a topic of current interest in our lab is whether Rossy signaling involves Akt activation and calcium mobilization.
The functional conservation in mutants lacking the active-site histidine suggests that Rossy can elicit biological responses independently of a catalytic activity. However, both Rossy and other sPLA2s are capable of lipid hydrolysis (14, 31, 58), and there is evidence for a phospholipase A2 enzymatic activity in early zebra fish development. Therefore, the range of biological effects of the sPLA2s might be dependent on both modes of signaling. In support of a lipid hydrolysis-independent activity of sPLA2s, both the Rossy's zebra fish homolog (14) and the group XIII sPLA2 (GenBank accession number Q99P27) lack the active-site histidine.
Overall, we have demonstrated that Rossy signaling can act to modulate BMP/TGFß pathways and promote neurogenesis. The activity of this factor has been remarkably conserved, suggesting an ancestral function. The maternal expression of the Drosophila and Xenopus Rossy, and the expression of the mammalian orthologs in pluripotent ES cells, suggests that it might also modulate these pathways in embryonic stem cell differentiation.
| ACKNOWLEDGMENTS |
|---|
This work is funded by NIH grant HD32105 to A.H.B. and a Helen Hay Whitney Foundation fellowship to I.M.-S.
| FOOTNOTES |
|---|
Present address: Merck Sharp & Dohme, The Neuroscience Research Centre, Terlings Park, Essex CM20 2QR, United Kingdom. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Ancian, P., G. Lambeau, M. G. Mattei, and M. Lazdunski. 1995. The human 180-kDa receptor for secretory phospholipases A2. Molecular cloning, identification of a secreted soluble form, expression, and chromosomal localization. J. Biol. Chem. 270:8963-8970.
3. Baker, J. C., and R. M. Harland. 1996. A novel mesoderm inducer, Madr2, functions in the activin signal transduction pathway. Genes Dev. 10:1880-1889.
4. Buck, A., A. Kispert, and J. Kohlhase. 2001. Embryonic expression of the murine homologue of SALL1, the gene mutated in Townes-Brocks syndrome. Mech. Dev. 104:143-146.[CrossRef][Medline]
5. Carcamo, J., A. Zentella, and J. Massague. 1995. Disruption of transforming growth factor beta signaling by a mutation that prevents transphosphorylation within the receptor complex. Mol. Cell. Biol. 15:1573-1581.[Abstract]
6. Casellas, R., and A. H. Brivanlou. 1998. Xenopus Smad7 inhibits both the activin and BMP pathways and acts as a neural inducer. Dev. Biol. 198:1-12.[CrossRef][Medline]
7. Cho, K. W., B. Blumberg, H. Steinbeisser, and E. M. De Robertis. 1991. Molecular nature of Spemann's organizer: the role of the Xenopus homeobox gene goosecoid. Cell 67:1111-1120.[CrossRef][Medline]
8. Cupillard, L., K. Koumanov, M. G. Mattei, M. Lazdunski, and G. Lambeau. 1997. Cloning, chromosomal mapping, and expression of a novel human secretory phospholipase A2. J. Biol. Chem. 272:15745-15752.
9. Cupillard, L., R. Mulherkar, N. Gomez, S. Kadam, E. Valentin, M. Lazdunski, and G. Lambeau. 1999. Both group IB and group IIA secreted phospholipases A2 are natural ligands of the mouse 180-kDa M-type receptor. J. Biol. Chem. 274:7043-7051.
10. de Celis, J. F., R. Barrio, and F. C. Kafatos. 1996. A gene complex acting downstream of dpp in Drosophila wing morphogenesis. Nature 381:421-424.[CrossRef][Medline]
11. de Celis, J. F., R. Barrio, and F. C. Kafatos. 1999 Regulation of the spalt/spalt-related gene complex and its function during sensory organ development in the Drosophila thorax. Development 126:2653-2662.[Abstract]
12. Ebisawa, T., M. Fukuchi, G. Murakami, T. Chiba, K. Tanaka, T. Imamura, and K. Miyazono. 2001. Smurf1 interacts with transforming growth factor-beta type I receptor through Smad7 and induces receptor degradation. J. Biol. Chem. 276:12477-12480.
13. Gammill, L. S., and H. Sive. 2000. Coincidence of otx2 and BMP4 signaling correlates with Xenopus cement gland formation. Mech. Dev. 92:217-226.[CrossRef][Medline]
14. Gelb, M. H., E. Valentin, F. Ghomashchi, M. Lazdunski, and G. Lambeau. 2000. Cloning and recombinant expression of a structurally novel human secreted phospholipase A2. J. Biol. Chem. 275:39823-39826.
15. Gong, Q., and M. T. Shipley. 1995. Evidence that pioneer olfactory axons regulate telencephalon cell cycle kinetics to induce the formation of the olfactory bulb. Neuron 14:91-101.[CrossRef][Medline]
16. Harland, R. 1991. In situ hybridization: an improved wholemount method for Xenopus embryos. Methods Cell Biol. 36:675-678.[Medline]
17. Harland, R., and J. Gerhart. 1997. Formation and function of Spemann's organizer. Annu. Rev. Cell Dev. Biol. 13:611-667.[CrossRef][Medline]
18. Hata, A., G. Lagna, J. Massague, and A. Hemmati-Brivanlou. 1998. Smad6 inhibits BMP/Smad1 signaling by specifically competing with the Smad4 tumor suppressor. Genes Dev. 12:186-197.
19. Hata, A., J. Seoane, G. Lagna, E. Montalvo, A. Hemmati-Brivanlou, and J. Massague. 2000. OAZ uses distinct DNA- and protein-binding zinc fingers in separate BMP-Smad and Olf signaling pathways. Cell 100:229-240.[CrossRef][Medline]
20. Hayashi, H., S. Abdollah, Y. Qiu, J. Cai, Y. Y. Xu, B. W. Grinnell, M. A. Richardson, J. N. Topper, M. A. Gimbrone, Jr., J. L. Wrana, and D. Falb. 1997. The MAD-related protein Smad7 associates with the TGFbeta receptor and functions as an antagonist of TGFbeta signaling. Cell 89:1165-1173.[CrossRef][Medline]
21. Hebert, J. M., M. Lin, J. Partanen, J. Rossant, and S. K. McConnell. 2003. FGF signaling through FGFR1 is required for olfactory bulb morphogenesis. Development 130:1101-1111.
22. Hemmati-Brivanlou, A., and D. A. Melton. 1994. Inhibition of activin receptor signaling promotes neuralization in Xenopus. Cell 77:273-281.[CrossRef][Medline]
23. Hernandez, M., S. L. Burillo, M. S. Crespo, and M. L. Nieto. 1998. Secretory phospholipase A2 activates the cascade of mitogen-activated protein kinases and cytosolic phospholipase A2 in the human astrocytoma cell line 1321N1. J. Biol. Chem. 273:606-612.
24. Hill, R. E., J. Favor, B. L. Hogan, C. C. Ton, G. F. Saunders, I. M. Hanson, J. Prosser, T. Jordan, N. D. Hastie, and V. van Heyningen. 1991. Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 354:522-525.[CrossRef][Medline]
25. Hogan, B. L., E. M. Hirst, G. Horsburgh, and C. M. Hetherington. 1988. Small eye (Sey): a mouse model for the genetic analysis of craniofacial abnormalities. Development 103(Suppl.):115-119.
26. Hollemann, T., R. Schuh, T. Pieler, and R. Stick. 1996. Xenopus Xsal-1, a vertebrate homolog of the region specific homeotic gene spalt of Drosophila. Mech. Dev. 5:19-32.
27. Kavsak, P., R. K. Rasmussen, C. G. Causing, S. Bonni, H. Zhu, G. H. Thomsen, and J. L. Wrana. 2000. Smad7 binds to Smurf2 to form an E3 ubiquitin ligase that targets the TGF beta receptor for degradation. Mol. Cell 6:1365-1375.[CrossRef][Medline]
28. Kiefer, S. M., B. W. McDill, J. Yang, and M. Rauchman. 2002. Murine Sall1 represses transcription by recruiting a histone deacetylase complex. J. Biol. Chem. 277:14869-14876.
29. Lagna, G., A. Hata, A. Hemmati-Brivanlou, and J. Massague. 1996. Partnership between DPC4 and SMAD proteins in TGF-beta signalling pathways. Nature 383:832-836.[CrossRef][Medline]
30. LaMantia, A. S., M. C. Colbert, and E. Linney. 1993. Retinoic acid induction and regional differentiation prefigure olfactory pathway formation in the mammalian forebrain. Neuron 10:1035-1048.[CrossRef][Medline]
31. Lambeau, G., L. Cupillard, and M. Lazdunski. 1997. Membrane receptors for venom phospholipase A2, p. 389-412. In R. M. Kini (ed.), Venom phospholipase A2 enzymes: structure, function and mechanism. John Wiley & Sons, Chichester, United Kingdom.
32. Latinkic, B. V., M. Umbhauer, K. A. Neal, W. Lerchner, J. C. Smith, and V. Cunliffe. 1997. The Xenopus Brachyury promoter is activated by FGF and low concentrations of activin and suppressed by high concentrations of activin and by paired-type homeodomain proteins. Genes Dev. 11:3265-3276.
33. Liu, F., A. Hata, J. C. Baker, J. Doody, J. Carcamo, R. M. Harland, and J. Massague. 1996. A human Mad protein acting as a BMP-regulated transcriptional activator. Nature 381:620-623.[CrossRef][Medline]
34. Liu, F., C. Pouponnot, and J. Massague. 1997. Dual role of the Smad4/DPC4 tumor suppressor in TGFbeta-inducible transcriptional complexes. Genes Dev. 11:3157-3167.
35. Long, J. E., S. Garel, M. J. Depew, S. Tobet, and J. L. R. Rubenstein. 2003. DLX5 regulates development of peripheral and central components of the olfactory system. J. Neurosci. 23:568-578.
36. Marsh-Armstrong, N., H. Huang, D. L. Berry, and D. D. Brown. 1999. Germ-line transmission of transgenes in Xenopus laevis. Proc. Natl. Acad. Sci. USA 96:14389-14393.
37. Massague, J., and Y. Chen. 2000. Controlling TGF-ß signaling. Genes Dev. 14:627-644.
38. Mathers, P. H., and M. Jamrich. 2000. Regulation of eye formation by the Rx and Pax6 homeobox genes. Cell. Mol. Life Sci. 57:186-194.[CrossRef][Medline]
39. Mathers, P. H., A. Grinberg, K. A. Mahon, and M. Jamrich. 1997. The Rx homeobox gene is essential for vertebrate eye development. Nature 387:603-607.[CrossRef][Medline]
40. Meyers, E. N., M. Lewandoski, and G. R. Martin. 1998. An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination. Nat. Genet. 18:136-141.[CrossRef][Medline]
41. Muñoz-Sanjuán, I. and A. H. Brivanlou. 2001. Early posterior/ventral fate specification in the vertebrate embryo. Dev. Biol. 237:1-17.[CrossRef][Medline]
42. Muñoz-Sanjuán, I., and A. H. Brivanlou. 2002. Neural induction, the default model and embryonic stem cells. Nat. Rev. Neurosci. 3:271-280.[CrossRef][Medline]
43. Muñoz-Sanjuán, I., E. Bell, C. R. Altmann, A. Vonica, and A. H. Brivanlou. 2002. Gene profiling during neural induction in Xenopus laevis: regulation of BMP signaling by post-transcriptional mechanisms and TAB3, a novel TAK1-binding protein. Development 129:5529-5540.
44. Muñoz-Sanjuán, I. and A. H. Brivanlou. Modulation of BMP signaling during vertebrate gastrulation. In C. Stern (ed.), Vertebrate gastrulation, in press. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
45. Murakami, M., S. Shimbara, T. Kambe, H. Kuwata, M. V. Winstead, J. A. Tischfield, and I. Kudo. 1998. The functions of five distinct mammalian phospholipase A2s in regulating arachidonic acid release. J. Biol. Chem. 273:14411-14423.
46. Murakami, M., Y. Nakatani, G. Atsumi, K. Inoue, and I. Kudo. 1997. Regulatory functions of phospholipase A2. Crit. Rev. Immunol. 17:225-283.[Medline]
47. Nakao, A., M. Afrakhte, A. Moren, T. Nakayama, J. L. Christian, R. Heuchel, S. Itoh, M. Kawabata, N. E. Heldin, C. H. Heldin, and P. ten Dijke. 1997. Identification of Smad7, a TGF beta-inducible antagonist of TGF-beta signalling. Nature 389:631-635.[CrossRef][Medline]
48. Nicolas, J. P., Y. Lin, G. Lambeau, F. Ghomashchi, M. Lazdunski, and M. H. Gelb. 1997. Localization of structural elements of bee venom phospholipase A2 involved in N-type receptor binding and neurotoxicity. J. Biol. Chem. 272:7173-7181.
49. Nomura, T., M. M. Khan, S. C. Kaul, H. D. Dong, R. Wadhwa, C. Colmenares, I. Kohno, and S. Ishii. 1999. Ski is a component of the histone deacetylase complex required for transcriptional repression by Mad and thyroid hormone receptor. Genes Dev. 13:412-423.
50. Ott, T., K. H. Kaestner, A. P. Monaghan, and G. Schutz. 2001. The mouse homolog of the region specific homeotic gene spalt of Drosophila is expressed in the developing nervous system and in mesoderm-derived structures. Mech. Dev. 56:117-128.
51. Sato, N., I. M. Sanjuan, M. Heke, M. Uchida, F. Naef, and A. H. Brivanlou. 2003. Molecular signature of human embryonic stem cells and its comparison with the mouse. Dev. Biol. 260:404-413.[CrossRef][Medline]
52. Schuldiner, M., O. Yanuka, J. Itskovitz-Eldor, D. A. Melton, and N. Benvenisty. 2000. Effects of eight growth factors on the differentiation of cells derived from human embryonic stem cells. Proc. Natl. Acad. Sci. USA 97:11307-11312.
53. Simpson, T. I., and D. J. Price. 2002. Pax6: a pleiotropic player in development. Bioessays 24:1041-1051.[CrossRef][Medline]
54. Six, D. A., and E. A. Dennis. 2000. The expanding superfamily of phospholipase A(2) enzymes: classification and characterization. Biochim. Biophys. Acta 1488:1-19.[Medline]
55. Stroschein, S. L., W. Wang, S. Zhou, Q. Zhou, and K. Luo. 1999. Negative feedback regulation of TGF-beta signaling by the SnoN oncoprotein. Science 286:771-774.
56. Suzuki, N., J. Ishizaki, Y. Yokota, K. Higashino, T. Ono, M. Ikeda, N. Fujii, K. Kawamoto, and K. Hanasaki. 2000. Structures, enzymatic properties, and expression of novel human and mouse secretory phospholipase. J. Biol. Chem. 275:5785-5793.
57. Tang, S. J., P. A. Hoodless, Z. Lu, M. L. Breitman, R. R. McInnes, J. L. Wrana, and M. Buchwald. 1998. The Tlx-2 homeobox gene is a downstream target of BMP signalling and is required for mouse mesoderm development. Development 125:1877-1887.[Abstract]
58. Valentin, E., and G. Lambeau. 2000. Increasing molecular diversity of secreted phospholipases A(2) and their receptors and binding proteins. Biochim. Biophys. Acta 1488:59-70.[Medline]
59. Wang, S. S., R. Y. Tsai, and R. R. Reed. 1997. The characterization of the Olf-1/EBF-like HLH transcription factor family: implications in olfactory gene regulation and neuronal development. J. Neurosci. 17:4149-4158.
60. Wang, W., F. V. Mariani, R. M. Harland, and K. Luo. 2000. Ski represses bone morphogenetic protein signaling in Xenopus and mammalian cells. Proc. Natl. Acad. Sci. USA 97:14394-14399.
61. Weinstein, D. C., J. Marden, F. Carnevali, and A. Hemmati-Brivanlou. 1998. FGF-mediated mesoderm induction involves the Src-family kinase Laloo. Nature 394:904-908.[CrossRef][Medline]
62. Whitman, M., and D. A. Melton. 1992. Involvement of p21ras in Xenopus mesoderm induction. Nature 357:252-254.[CrossRef][Medline]
63. Wilson, P. A., and A. Hemmati-Brivanlou. 1995. Induction of epidermis and inhibition of neural fate by Bmp-4. Nature 376:331-333.[CrossRef][Medline]
64. Wotton, D., R. S. Lo, S. Lee, and J. Massague. 1999. A smad transcriptional corepressor. Cell 97:29-39.[CrossRef][Medline]
65. Wu, H.-H., S. Ivkovic, R. C. Murray, S. Jaramillo, K. Lyons, J. E. Johnson, and A. L. Calof. 2003. Autoregulation of neurogenesis by GDF11. Neuron 37:197-207.[CrossRef][Medline]
66. Xu, W., K. Angelis, D. Danielpour, M. M. Haddad, O. Bischof, J. Campisi, E. Stavnezer, and E. E. Medrano. 2000. Ski acts as a corepressor with Smad2 and Smad3 to regulate the response to type beta transforming growth factor. Proc. Natl. Acad. Sci. USA 97:5924-5929.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|