Identification of Splicing Silencers and Enhancers in Sense Alus: a Role for Pseudoacceptors in Splice Site Repression

Auxiliary splicing signals in introns play an important rolein splice site selection, but these elements are poorly understood.We show that a subset of serine/arginine (SR)-rich proteinsactivate a cryptic 3' splice site in a sense Alu repeat locatedin intron 4 of the human LST1 gene. Utilization of this crypticsplice site is controlled by juxtaposed Alu-derived splicingsilencers and enhancers between closely linked short tandemrepeats TNFd and TNFe. Systematic mutagenesis of these elementsshowed that AG dinucleotides that were not preceded by purineresidues were critical for repressing exon inclusion of a chimericsplicing reporter. Since the splice acceptor-like sequencesare present in excess in exonic splicing silencers, these signalsmay contribute to inhibition of a large number of pseudositesin primate genomes.

INTRODUCTION

Top

Introduction

Most eukaryotic genes contain introns that are removed frompre-mRNAs by splicing. The removal of introns occurs in twosequential transesterification reactions that are catalyzedby a large ribonucleoprotein (RNP) complex termed the spliceosome(10). The formation of the spliceosome involves the stepwiseassembly of snRNPs (U1, U2, U4/U6, and U5) and a large numberof non-snRNP proteins on a pre-mRNA. The spliceosome assemblyis characterized by multiple and relatively weak interactionsthat require conserved cis-acting elements in the pre-mRNA:the 5' splice site (5' ss), 3' ss, polypyrimidine tract (PPT),and the branchpoint sequence (BPS). In higher eukaryotes, theseconsensus signals are necessary but often insufficient to defineexon-intron boundaries and efficient splicing requires auxiliarycis elements that activate or repress splicing, known as exonicsplicing enhancers (ESEs) and intronic splicing enhancers orexonic splicing silencers (ESSs) and intronic splicing silencers.These signals allow the genuine splice sites to be correctlyrecognized among a vast excess of pseudosites that have similarsequences but outnumber authentic splice sites by an order ofmagnitude (10, 22, 60). The auxiliary signals have been identifiedthrough mutations that alter splicing, through computationalcomparisons, and through selection of sequences that activateor repress splicing or bind to splicing regulatory proteins(16, 23, 61, 65, 68). Exonic sequences, which often regulateboth constitutive and alternative splicing through binding ofserine/arginine-rich (SR) proteins (6, 27) and are importantfor exon definition (3), have been studied more extensivelythan auxiliary signals in introns. In particular, repressionof pseudosites by intronic splicing silencers has been poorlyunderstood (22, 60).

Introns contain several classes of repetitive elements thathave been shown to influence pre-mRNA splicing. Short tandemrepeats (STRs), or 1- to 6-bp iterative motifs called microsatellites,were reported to affect pre-mRNA splicing of at least four humangenes if located close to the 3' or 5' ss (1, 25, 28, 33, 51).Alu repeats, the largest family of mobile elements in the humangenome (2), can be exonized by a single or two point mutationsif they are in the antisense orientation (44, 47, 58) and providea source of ready-to-use segments with a coding potential (45,46). In yeast (Saccharomyces cerevisiae), extensive self-complementarityin intronic sequences has been shown to promote exon definition(32), suggesting that repetitive sequences could have a moregeneral and underappreciated role in gene expression.

The LST1 gene encodes a leukocyte-specific transcript with apredominant expression in monocytes and dendritic cells (31,52). LST1 generates at least 14 alternatively spliced variants(designated LST1/A to LST1/N) that encode transmembrane as wellas soluble molecules (53). The predicted polypeptides vary withregard to the presence of the N- and C-terminal sequences andhave been shown to differentially stimulate lymphocyte proliferation,suggesting that LST1 plays a role in the immune system (19,53). Overexpression of LST1 isoforms that contain the transmembranedomain induced the formation of long filopodia and microspikesat the cell surface (52), but the exact function of the geneis not understood. LST1 is located in the major histocompatibilitycomplex class III region centromeric of the gene for tumor necrosisfactor alpha (TNF- ${alpha}$ ) in an area predicted to encode genes thathave a role in mRNA processing (42). The LST1 gene containswell-known STRs that were termed TNFd and TNFe (63) and mappedclose to the alternative 3' ss of intron 4 (31).

Here, we have investigated a role of TNFd and surrounding sequencesin alternative splicing of LST1. We show that an SR-inducedactivation of a cryptic splice acceptor located in a sense Alurepeat between TNFd and TNFe is influenced by a downstream Alu-derivedsegment that contains juxtaposed splicing silencers. Systematicmutagenesis of these elements in a heterologous context revealedthat AG dinucleotides that were not preceded by purine residueswere critical for the inclusion of Alu-derived sequences inmature transcripts. Since these acceptor-like sequences areoverrepresented in ESSs, we propose that they play an importantrole in suppressing a large number of pseudosplice sites inthe primate genomes.

MATERIALS AND METHODS

Top

Materials and Methods

Minigene constructs and site-directed mutagenesis. The LST1 minigene was cloned into pCR3.1 (Invitrogen) with primers1F (5'-AACTGTTGGAGAGGGAATCTGAGA) and 1R (5'-ATTCAAAGGTCAAAAAGCCACATA)(Fig. 1A). This minigene contains TNFd allele d3 characterizedby a (AG)₁₄GG(AG)₉ repeat. The allelic structure of TNFd andTNFe is shown in Table S1 in the supplemental material. TheXPC construct, which was derived from the human gene deficientin xeroderma pigmentosum (group C) and contains exons 3 through5, was cloned into EcoRV/XbaI sites of pCR3.1 with primers 5'-CGTAGATATCATCTTCCTTCCTGTGGTCTTTACACand 5'-TAGCTCTAGACTTCCCCATCATTCCTTGCCCTTAC. The truncated XPCconstruct XPC-T was created with mutagenic primers xpc-din3-f(AAGAAGGCTGAGACTGTCTGGGTTGTGTGG) and xpc-din3-r (CAGACAGTCTCAGCCTTCTTTGGTAACTTG).The TH minigene, which contains exons 11 through 13 of the humangene for tyrosine hydroxylase, was cloned into EcoRI/XbaI sitesof the same expression vector using primers 5'-GACTGAATTCGGCTGCCTCTCCCCATCCTTCand 5'-GATCTCTAGAAGCAGCCTAGCCCACCTGAGC. The chimeric XPC andTH minigenes were prepared by inserting Alu-derived LST1 segments24 nucleotides (nt) downstream of the 3' ss of XPC intron 3and TH intron 11. An ASF/SF2 cDNA clone containing a 21-nt deletion(CGGCGGGGGTGGAGGTGGCGG) that removes a heptaglycine stretchbetween RNA recognition motif 1 (RRM1) and RRM2 was obtainedby amplifying cDNAs prepared from HeLa cells with primers A1(ATCCTCGAGATGTCGGGAGGTGGTGTGATT)and A2 (ATCACGCGTCAACATGGGTTCTACAAAAAG).

View larger version (31K):
[in this window]
[in a new window]
FIG. 1. SR-dependent activation of a cryptic 3' splice site in LST1. (A) Schematic representation of the LST1 minigene (to scale; scale units are kilobases). Exons are shown as shadowed boxes; introns are shown as lines. TNFe and TNFd are indicated by small open boxes; segment A is denoted by a closed rectangle. Arrows indicate primers. For a full genomic sequence of this region, see Fig. S1 in the supplemental material. Naturally occurring LST1 isoforms arising by alternative 3' ss and designated LST1/C, LST1/K (53), and LST1/O (this study) are shown above the minigene, whereas cryptic 3' ss activation generating LST1/n is shown below. The location of the alternative 3' ss of intron 4 was as described in reference 53 (and see Fig. S1 in the supplemental material). (B) Cryptic 3' ss activation in cells overexpressing SR proteins in constructs lacking TNFd. LST1 reporters are shown below each panel, and LST1 RNA products are shown to the right. LST1/K is a predominant isoform in peripheral blood mononuclear cells generated by alternative 3' ss of intron 4 (53). WT, wild-type; NC and VO; no-cotransfection and vector-only controls, respec-tively. No-template controls are not shown. (C) SR-dependent upregulation of LST1/n and LST1/C. We used 0.5 µg of each reporter plasmid together with 0.1, 0.5, 1.0, and 2.0 µg of plasmids expressing SRp40. Hd, heteroduplexes. (D) Binding of ASF/SF2 to the pre-mRNA is essential for the LST1/n formation. d, deletion of ASF/SF2 domains RRM1, RRM2, and RS or a heptaglycine repeat (Gly7). LST1 isoforms described above are shown on the right side.

Mutated clones were obtained by two-step overlap extension PCR(30). A $->$ G mutations of the predicted branchpoint (BP) adeninesof XPC exon 4 and TH exon 12 were introduced with mutagenicprimers 5'-ACTATTACTGGTTTTTAAAAA and 5'-CTCTGGGCTGGTGCTGCCCGGC,respectively (mutation is in bold). BPs of both exons were mappedpreviously in case reports of disease-causing BPS mutationsthat produced splicing defects (34, 39) and through our owninvestigation (I.V. et al., in preparation). A 48-bp polylinker(PL) sequence (ACTAGTGCGGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCAACGC)was used for TNFd replacements to generate constructs TNFd-PL(Fig. 1B). Clone TNFd-(AG)₀-A>PL was prepared by replacingsegment A (Fig. 1A) with the first 38 bp of PL, except for anA-to-T transversion (in bold in the PL sequence) to destroya potential 3' AG. All wild-type and mutated reporter constructswere sequenced using the automated ABI377 sequencer as describedpreviously (64) to confirm intended changes and exclude cloneswith undesired mutations. ASF/SF2 constructs described previously(12) were a generous gift of G. Screaton (University of Oxford)and J. Cáceres (University of Edinburgh). Wild-type andmutated ASF/SF2 constructs were validated by sequencing.

Cell cultures and transfection. Transient transfections were performed in six-well (growth area,9.4 cm²) plates with FuGENE 6 (Roche) as described previously(41). The plating density was 1.5 x 10⁵. When reaching $~$ 50% confluence,the medium was changed 2 h before adding DNA mixture, whichwas prepared by combining 3 µl of FuGENE and 50 µlof serum-free medium, followed by addition of plasmid DNA (1µg, except for cotransfection experiments [see figurelegends]) purified with the Wizard Plus SV Minipreps (Promega).The DNA mixture was incubated for 20 min at room temperatureprior to transfections. Cells were harvested for RNA extraction48 h posttransfection. The amounts of plasmids expressing SRproteins are shown in the figure legends.

RNA extraction and detection of RNA products. Total RNA was extracted using Tri reagent (Sigma) accordingto the manufacturer's recommendation and measured on a spectrophotometer.Five hundred nanograms of RNA was reverse transcribed with primerPL2 (CCGACTAGTCGCCCAAAT) and Moloney murine leukemia virus reversetranscriptase (RT; Promega) at 42°C. RT was inactivatedfor 5 min at 95°C. RT-PCR was performed with vector primersPL1 (ACTCACTATAGGGAGACC) and PL2 and validated by a combinationof vector and cDNA primers 2F (TCTGTCCGCCTGCCTGTGTTG) and 2R(GGATCCTCCTTGGTGCCTCTC; Fig. 1A). PCR products were separatedon polyacrylamide (Fig. 1C) or agarose gels. RNA products wereconfirmed by sequencing as described previously (64). The relativeratios of RNA products were measured with FluorImager 595 usingFluorQuant and Phoretix software packages (Nonlinear DynamicsInc.) for at least two transfections in duplicate as describedpreviously (41).

RESULTS

Top

Results

SR-mediated activation of a cryptic 3' ss in LST1 intron 4. TNFd and TNFe are highly polymorphic STRs located upstream ofthe alternative 3' ss of LST1 intron 4 (Fig. 1A). To determinetheir organization, we sequenced both STRs in cell lines homozygousin the major histocompatibility complex (see Table S1 in thesupplemental material). The structure of TNFd was (AG)_12-16GG(AG)_9-11on the analyzed haplotypes, whereas TNFe was a simple (AG)_7-9repeat. To test if TNFd, which is located $~$ 70 bp upstream ofthe proximal splice acceptor site (Fig. 1A; and see Fig. S1in the supplemental material), can influence alternative 3'ss selection, we transfected minigene constructs that containedTNFd allele d3 [(AG)₁₄GG(AG)₉, minigene TNFd-WT], a TNFd deletion[TNFd-(AG)₀], and a PL sequence replacing TNFd (minigene TNFd-PL)into 293T cells. Examination of the minigene splicing patternshowed that splicing reporters lacking TNFd generated RNA productsidentical to those observed for the wild-type minigene (datanot shown), suggesting that TNFd does not influence splicing.

To test if factors known to affect RNA processing influenceselection of alternative 3' ss, we cotransfected the splicingreporters with a panel of plasmids expressing SR proteins. Coexpressionof TNFd-(AG)₀ and TNFd-PL, but not the wild-type construct,with ASF/SF2, SRp40, SRp55, SRp75, and, to a minor extent, 9G8and SC35 in both 293T (Fig. 1B) and HeLa (data not shown) cellsactivated an upstream cryptic 3' ss located between TNFe andTNFd. The resulting isoform was termed LST1/n (Fig. 1A, B).The LST1/n expression increased with increasing amounts of plasmidsexpressing SRp40 (Fig. 1C) and ASF/SF2 (data not shown) cotransfectedwith TNFd-(AG)₀ or TNFd-PL constructs. In addition, we observedupregulation of isoform LST1/C described previously (53) anddownregulation of a novel isoform designated LST1/O, consistentwith promotion of proximal splicing by a subset of SR proteins(Fig. 1A to C), as described first for ASF/SF2 (40).

Since most SR proteins that produced significant amounts ofLST1/n had two RRMs (ASF/SF2, SRp40, SRp55, SRp75) (27) andthose lacking the second RRM (SC35, 9G8) generated little LST1/n(Fig. 1B), we tested the importance of their modular domains.We cotransfected the TNFd-(AG)₀ construct with the wild-typeASF/SF2 and ASF/SF2 lacking RRM1, RRM2, the C-terminal RS domain(13), and a heptaglycine tract between RRM1 and RRM2 (see Materialsand Methods). Deletion of either RRM1 or RRM2 eliminated LST1/n(Fig. 1D). In contrast, deletion of the RS domain and the interveningheptaglycine only reduced the LST1/n yield, suggesting thatthe SR-induced activation of cryptic 3' ss depends on bindingof SR proteins to the pre-mRNA and only partially on contactsmade by the RS domain.

Identification of splicing silencers in sense Alu sequences. Interestingly, a search for sequences homologous to the regionbetween TNFe and TNFd showed that the SR-induced cryptic 3'ss was located in the free left Alu monomer (FLAM) (Fig. 2A;see also Fig. S1 in the supplemental material). Alus are dimeric $~$ 300-nt repeats that probably originated from a fusion betweenthe left and right Alu monomers (35). Alus in antisense orientationare amenable to exonization as they contain a strong PPT andmany potential 3' and 5' ss, whereas exonization of sense Alusis rare (44, 57, 58). The presence of the cryptic 3' ss in thesense Alu element (Fig. 2A) thus provided an opportunity toexamine Alu-derived sequences that repress splicing.

View larger version (36K):
[in this window]
[in a new window]
FIG. 2. Identification of Alu-derived splicing signals that inhibit LST1/n. (A) Cryptic 3' ss and segment A sequences are derived from Alu repeats. Sequence alignment was generated by the RepeatMasker (http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker). The cryptic 3' ss (position 33/34 in the Alu consensus sequence) (2, 37) is boxed. Deleted segments A1 (positions 40 to 51 in the Alu consensus), A2 (positions 51 to 66), A3 (positions 66 to 77), and A4 (positions 78 to 96) are underlined. The telomeric end of TNFd is shown as a gray bar. Mismatches are indicated by the letter i (transition) or v (transversion). (B) Activation of cryptic 3' ss upon removal of segment A3 or A2. The amount of plasmid expressing ASF/SF2 is in micrograms. Mutated constructs (bottom) are described in the text. d, deletion; >, replacement. PL refers to a polylinker sequence. Expression of LST1/C and LST1/O was negligible and is not shown. Reporter constructs containing the TNFd repeat that lacked segment A were not obtained because of a detection bias against RNA isoforms with this STR (see Fig. 1B and Discussion). (C) A3 and A2 in the sense orientation promote skipping of XPC exon 4. (Upper panel) Mutated minigenes transfected into 293T cells are shown at the top. F and R, forward (sense) and reverse (antisense) orientation, respectively. ES, exon skipping as a ratio of transcripts lacking exon 4 (E4–) to the sum of E4– and E4+ transcripts. SD, standard deviation as calculated from two transfection experiments. (Lower panel) ES following transfection of the truncated (T) XPC minigene carrying identical insertions.

To map cis-elements important for the LST1/n formation, we constructeda splicing reporter lacking a 38-bp segment (termed A) locatedbetween the cryptic 3' ss and TNFd (Fig. 1A; see also Fig. S1in the supplemental material). Interestingly, transfection ofmutated constructs and sequencing of the resulting RNAs showedthat this deletion activated the same cryptic 3' ss in the absenceof transiently expressed SR proteins (Fig. 2B). Replacementof this segment with a vector sequence of identical length hadthe same effect (Fig. 2B). Further mapping of segment A, whichwas subdivided into three subregions termed A1 to A3 (Fig. 1Aand 2A), showed that deletion of A2 and A3 promoted crypticsplicing, whereas deletion of A1 did not (Fig. 2B), suggestingthat A3 and A2 contain splicing silencers important for theLST/n repression.

To test how the silencers affect splicing in a heterologouscontext, we individually inserted A1-to-A3 subregions in boththe sense and antisense orientations into the central exon ofa minigene carrying exons 3 through 5 of the XPC gene. Intron3 of the wild-type XPC minigene has a weak 3' ss and generatesan excess of exon inclusion over exon skipping, thus providinga suitable system for testing putative splicing repressors (Fig.2C). Insertion of A2 or A3 in the sense orientation resultedin almost full exon skipping, whereas insertion of A1 had onlya minor effect. In the antisense orientation, A1 and A2 constructsproduced exon inclusion levels similar to those of the wild-typeXPC, whereas insertion of A3 moderately decreased exon inclusion.Similar levels of exon skipping were produced by a truncatedconstruct (termed XPC-T), in which XPC intron 3 was shortenedfrom $~$ 2.1 kb to $~$ 450 bp to facilitate mutagenesis (Fig. 2C, lowerpanel). In addition to XPC, the insertion of A3 in the senseorientation into a minigene carrying exons 11 through 13 ofthe human TH gene, which produced a mixture of exon inclusionand exon skipping in the wild type (see further below), alsoled to exon repression (data not shown). Together, these resultssuggested that A2 and A3 contained splicing silencers derivedfrom sense Alus.

Importance of AG dinucleotides for A3-mediated exon repression. To determine which A3 residues are critical for splicing, wesystematically mutated each A3 position in minigene XPC-T-A3Fto the remaining nucleotides. This XPC-T construct containeda 12-nt segment A3 that was inserted in the sense orientationin the central XPC exon. Transfection of mutated constructsinto 293T cells and examination of exon inclusion showed that,unlike any other A3 dinucleotides, each single substitutionof A₉G₁₀ dramatically reduced exon skipping (Fig. 3A) as comparedto the wild-type XPC-T-A3F. Similarly, mutations of A₄G₅ tocytosines significantly enhanced exon inclusion (Fig. 3A). Incontrast, mutations at positions 3 and 6 led only to a minordecrease of exon skipping, whereas the remaining substitutionshad an intermediate effect (Fig. 3A). Of 10 non-C A3 positions,cytosine replacements in at least 6 of them showed a higherexon inclusion than the remaining nucleotides. These resultsindicated that AG dinucleotides were core A3 residues that promotedexon repression and that cytosines, which are underrepresentedin ESSs (65), were powerful enhancers of exon inclusion in mostA3 positions.

View larger version (47K):
[in this window]
[in a new window]
FIG. 3. Characterization of Alu-derived splicing silencer A3. (A) Exon inclusion levels following transfection of mutated A3 in XPC exon 4. Point mutations above each panel are numbered according to the A3 position as shown in panels B and C. ES, exon skipping as a ratio of transcripts lacking exon 4 (E4–) to the sum of E4– and E4+ transcripts. SD, standard deviation of two transfection experiments. (B) The influence of AG-AG distance in segment A3 on inclusion of a heterologous exon. (Left panel) Two-, 4-, and 6-nt insertions in the XPC-T-A3F construct. The XPC exon 4 sequences flanking A3 were GTGCTGGGTG (upstream) and ACGTGAGAGA (downstream). (Right panel) Exon inclusion levels from a single transfection experiment in duplicate. (C) Alignment of LST1 A3 segment and consensus sequences of Alu subfamilies. Alu sequences were derived from the left arm (2, 37), except for those denoted by -R (the right arm of Alu). The designation of Alu subfamilies was as described previously (2, 37). Mutations are shown in bold. (D) The influence of minigene mutations in A3 on exon inclusion. Constructs A to L shown at the top correspond to mutations listed in Fig. 3C.

Since A₄G₅ and A₉G₁₀ were separated by only three nucleotides,their repressive function might be related to interplay betweenthe two closely linked AGs, similar to the effect of neighboringAGs on 3' ss selection (18, 44). To examine whether the gapbetween the two AGs affects exon inclusion, we extended theA₄G₅-to-A₉G₁₀ distance in the XPC-T-A3F minigene from 5 to 7,9, and 11 nt as shown in Fig. 3B. Constructs extended by 2 and4 nt resulted in minor increase of exon inclusion levels, whereasfurther extension eliminated the difference. Thus, extendingthe AG-AG distance up to 9 nt slightly weakened repressive effecton exon inclusion, although we could not exclude an inhibitoryinfluence of short insertions per se.

Splicing activity of A3 sequences derived from Alu subfamilies. Alu repeats are composed of J, S, and Y families that are furthercategorized into subfamilies based on their sequence variability(2, 37). Alignment of LST1 segment A3 and sequences representativeof Alu subfamilies (Fig. 3C) showed that nucleotides 1, 6, and12, which were not essential for exon inclusion (Fig. 3A), werein the most variable positions. To test how natural variabilityof A3-like Alus affects splicing, we mutated the XPC-T-A3F minigeneto create constructs that corresponded to consensus sequencesof Alu subfamilies (Fig. 3C). Interestingly, splicing reporterswith variations in positions 9 and 10 showed the greatest reductionof exon skipping, whereas minigenes with mutations in positions1, 6, and 12 showed no or only minor alterations. A3 segmentsof Alu subfamilies that did not contain A₉G₁₀ induced only minoror moderate exon skipping (splicing reporters G, H, J, K, andL in Fig. 3C and D). Thus, A3 derived from FLAM_A, the leftarm of AluJo/Jb/S/Sx/Sq, and the right arm of AluJo remainedstrong inhibitors of exon inclusion, whereas segments representingthe remaining Alu subfamilies were less efficient silencers.

Characterization of Alu-derived splicing silencer A2. The importance of two AGs in A3 led us to examine the contributionof four AGs in segment A2 to exon skipping (Fig. 1A and 2A).We analyzed exon skipping in the truncated XPC construct, inwhich segment A2 was inserted in the central exon in the sameposition as A3. The splicing reporter (termed XPC-T-A2F) wasmutated in each AG. Figure 4A shows that guanosine-to-cytosinetransversions in the first two AGs markedly diminished exonskipping. The same mutation in the fourth AG also reduced exonskipping; however, mutation of the third AG showed little effect.

View larger version (44K):
[in this window]
[in a new window]
FIG. 4. Characterization of splicing silencer A2. (A) The influence of A2 mutations in four AGs on exon inclusion. The splicing reporter constructs are shown at the top. Guanine-to-cytosine mutations are in positions shown in panel B. ES, exon skipping as a ratio of transcripts lacking exon 4 (E4–) to the sum of E4– and E4+ transcripts. SD, standard deviation of two transfection experiments. (B) Alignment of LST1 segment A2 with consensus sequences of Alu subfamilies. Mutations (in bold) that corresponded to sequence variations in the subfamilies were introduced in segment A2 inserted in the XPC-T construct in the sense orientation. The designation of Alu subfamilies was as described previously (2, 37). (C) Influence of A2 variants representing Alu subfamilies on inclusion of XPC exon 4 in mRNA. Constructs A to M shown at the top correspond to mutations listed in Fig. 4B. A-R, constructs with segment A2 inserted in the antisense orientation.

To compare the influence of A2 segments that were representativeof Alu subfamilies, we prepared a series of mutated clones Bto M (Fig. 4B), transfected them into 293T cells, and examinedexon inclusion. Interestingly, exon inclusion levels correlatedwith the number of intact AGs (r = 0.66). Correlation was higher(r = 0.85) if minigene J, which contains a mutation in position15 important for splicing, was disregarded. The presence ofthree remaining AGs (clones K to M) generated about equal mixturesof exon inclusion and skipping, whereas the presence of onlyone AG was associated with low levels of skipping, except forAluYb8. Constructs containing two AGs (C to E, Fig. 4C) producedintermediate levels. Together, most A2 sequences representativeof the left arm of Alu showed only a minor increase of exonskipping, whereas those that were characteristic of the rightarm were more active.

Identification of a downstream splicing enhancer in sense Alu. Comparison of the newly exonized sequences in LST1/n with octamer(68)- and RESCUE (23)-derived enhancers revealed a cluster ofputative exonic splicing enhancers (designated A4; see TablesS2 and S3 in the supplemental material) located immediatelydownstream of segment A3 (Fig. 2A). We deleted the last 16 ntfrom segment A4 in the LST1 TNFd-(AG)₀ minigene, leaving thefirst 3 nt in the construct to maintain the flanking sequenceof A3 intact. Interestingly, transfection of this minigene intocells transiently expressing ASF/SF2 or SRp40 did not induceLST1/n (Fig. 5A), indicating that this element was criticalfor SR-induced activation of the cryptic 3' ss. Insertion ofA4 in both orientations into exon 12 of the TH minigene markedlyincreased exon inclusion (Fig. 5B), and insertion of both senseand antisense A4 segments into XPC exon 4 virtually eliminatedexon skipping (data not shown). Since there was no significantdifference in exon inclusion between the sense and antisenseorientations of A4 in either minigene, we compared the strengthof both inserts further in an XPC construct with weakened 3'ss. This construct was created by mutating the XPC-T minigenein the BP adenosine that was colocalized previously with a disease-causingmutation in a patient with xeroderma pigmentosum (39). The A $->$ Gmutation in predicted BP in the wild-type XPC-T minigene increasedexon skipping to over 90% (Fig. 5D). Insertion of A4F into theXPC-T construct with the BP A $->$ G mutation restored exon 4 inclusionto a level comparable to the wild-type XPC-T minigene, whereasA4R showed no effect, indicating that A4F is a stronger splicingenhancer than A4R. Similarly, insertion of A4F into the TH minigenecarrying an A $->$ G transition of the predicted exon 12 BP (34, 41)rescued splicing (data not shown). Together, these results suggestedthat A4 contains a splicing enhancer derived from a sense Aluthat promotes exon inclusion in a heterologous context.

View larger version (39K):
[in this window]
[in a new window]
FIG. 5. Identification and characterization of Alu-derived splicing enhancer A4. (A) Deletion of A4 in TNFd-(AG)₀ constructs eliminated the expression of SRp40- and ASF/SF2-induced LST1/n. We used 1 µg of plasmids expressing the two SR proteins and 0.5 µg of the reporter plasmid. NC, no-cotransfection controls. No-template controls are not shown. (B) Insertion of A4 into the TH minigene in both sense and antisense orientations resulted in full exon inclusion. The insertions were made in TH exon 12. ES, exon skipping as a ratio of transcripts lacking exon 12 (E12–) to the sum of E12– and E12+ transcripts. WT, wild type. SD, standard deviation as calculated from two transfection experiments. (C) Alignment of LST1 segment A4 with consensus sequences of Alu subfamilies. Mutations (in bold) that corresponded to sequence variations in the subfamilies were introduced in segment A4 inserted in the XPC-T construct in the sense orientation. The designation of Alu subfamilies was as described previously (2, 37). (D) Splicing of the XPC-T minigene containing the branchpoint A $->$ G mutation could be rescued by A4F but not by A4 sequences representing most Alu subfamilies. BP-G, constructs containing the adenine-to-guanine mutation in the predicted branchpoint of XPC exon 4. Constructs A to H shown at the top correspond to mutations listed in panel C. A-R, construct with segment A4 inserted in the antisense orientation.

Finally, to determine the extent to which sequence variabilityin segment A4 in Alu subfamilies influences splicing, we transfectedthe XPC-T minigene with the BP A $->$ G transition that was furthermutated in A4 as shown in Fig. 5C. In contrast to A4F, whichrescued splicing to a level comparable to that of the wild type(Fig. 5D), most A4 sequences derived from other Alu subfamiliesdid not generate significant exon inclusion, with AluSp-derivedA4 exhibiting a moderate effect.

DISCUSSION

Top

Discussion

We have shown the first examples of splicing silencers and enhancersin sense Alu repeats, providing additional evidence for splicingregulatory sequences in these mobile elements, first reportedfor antisense Alus (22, 60). Alus are primate specific and arepresent in hundreds of thousands of copies in the human genome,suggesting that splicing silencers identified in this studycontribute to repression of a large number of pseudoacceptorsites and that these repeats may provide a substantial reservoirof sequences that inhibit splicing. Since the Alu-derived splicingsilencers inhibited utilization of a cryptic 3' ss located inthe same repeat, they function to eliminate Alu exonization.

Examination of chimeric splicing reporters that contained thenewly identified inhibitory sequences highlighted the importanceof AG dinucleotides in splice site repression. AGs are commonlyfound in splicing silencer elements of both mammalian (17, 21,26, 38, 49) and viral (4, 54, 59, 62, 70) pre-mRNAs and arealso common in groups B and D to G of ESSs that have been recentlyidentified through comprehensive fluorescence-activated screens(FAS) (65). Although they were neither over- nor underrepresentedamong FAS ESSs (65), only 16 of 85 (18.8%) informative AGs foundin 133 nonrepetitive FAS ESS decamers were preceded by a purine,whereas the majority of the remaining AGs had uracil in thisposition (67/69; 97.1%). Similarly, only three of 79 (3.8%)informative FAS ESS AGs were preceded by purine dinucleotides,whereas 38/79 (48.1%) FAS ESS AGs were preceded by pyrimidinedinucleotides (P < 10^–4, assuming independence).

The occurrence of nucleotides that precede AGs in FAS ESSs (T₆₇>A₁₃>G₃>C₂)is similar to a C>T>A>G hierarchy observed for thevertebrate 3' ss (48, 56, 67), except for a depletion of cytosinesin this position among FAS ESSs. The efficiency of CAG 3' ssin in vitro splicing reactions was comparable to that of UAGs(56), raising speculation that a higher proportion of cytosinesversus uracils in position –3 of authentic 3' ss mightbe linked to a silencer effect of UAG pseudoacceptors. In additionto FAS ESS, UAGs predominate also in other ESSs (4, 21, 36,38, 54, 59, 66), although winner decamers identified by selectionexperiments contained cytosines in this position (22). Similarly,our inspection of previously identified ESSs (reviewed in reference69) showed that AGs preceded by dipurines were extremely rare,whereas RRAGs dominated purine-rich ESEs. This is consistentwith the observed lack of efficient exonization in our splicingreporter mutated in the third AG of A2, which was preceded bytwo purines (Fig. 4A). In addition, A3 mutations 3T and 8T thatintroduced uracils in front of the critical AG dinucleotideswere associated with almost full exon skipping, whereas an A32G mutation, which creates a dipurine in front of the same AG,increased exon inclusion (Fig. 3A).

The importance of AGs in repression of 3' ss selection is alsosupported by rare cases of disease-causing splicing mutationsthat create new AGs between BPS and authentic 3' AG. Althoughthey usually create de novo acceptor sites, as first describedfor HBB (11), at least several well-documented reports (7, 8,24, 29) showed that these AGs suppressed authentic acceptorsites, while activating a cryptic 3' ss further upstream ofthe BPS (I. Vo $r$ echovsk $y$ et al., in preparation).

Together, the above observations suggest that AGs representimportant motifs in the RNA splicing code that governs 3' ssselection. As for the splice-like sequences proposed to negativelyregulate authentic 5' ss (15, 21, 22, 55, 60, 65), inhibitorypseudoacceptors identified in this study may act in a similarmanner, most likely by recruiting components of the spliceosometo inappropriate places where they compete for interactionswith genuine 3' ss. These signals are likely to be partiallyrecognized by splicing factors such as U2 snRNP (36), but maynot assemble fully functional splicing complexes (50). The resultsof our initial experiment, in which the A₄G₅-A₉G₁₀ distancewas modified in segment A3 (Fig. 3B), were not inconsistentwith the notion that complexes assembled at the authentic 3'ss and A3 AGs share common spliceosomal components and similarAG-AG measuring mechanisms.

Segment A3 (Fig. 2B and 3B) contains an AGGG motif that waspreviously shown to interact with several trans-acting factors,including hnRNP A1 (9) and the H family of hnRNPs (5, 14). Interestingly,our inspection of FAS ESS sequences showed that guanosine wasthe most frequent nucleotide in a position that immediatelyfollowed FAS ESS AGs, whereas cytosines and adenines were underrepresented(G₄₄>T₃₃>A₂>C₁). In addition, all AGs in FAS ESS decamersthat were obtained twice in independent transfections were followedby guanine. GG dinucleotides were also overrepresented in twopositions that followed FAS ESS AGs (14 among 74 AGs, versusthe $~$ 5 expected; P < 0.001). However, the AGGG motif alonedid not appear to explain all the observed effects, since theA-to-G mutation in position 6 of A1 (Fig. 2A), which createsan AGGG signature, increased exon skipping only from $~$ 12 to $~$ 30%(data not shown). Our systematic mutagenesis showed (Fig. 3A)that AG dinucleotides in this motif were critical, whereas thesecond and third guanines in the G triplet were less importantfor exon repression. Thus, future studies should determine ifthese trans-acting factors differentially interact with RNAstranscribed from our mutated constructs.

The apparent lack of LST1/n in the wild-type construct (Fig.1B) could be due to a silencing effect of TNFd on cryptic 3'ss activation or impaired amplification and/or reverse transcriptionof repeat-containing transcripts. To address the latter hypothesis,we examined the amplification yield of plasmids with and withoutTNFd. The yield of PCR products was slightly lower for TNFd-containingplasmids than for those lacking the repeat (43). However, separatetranscription of the two plasmids in vitro and repeated treatmentwith DNase I followed by RT-PCR of mixed cDNAs showed a substantialdecrease of signal intensity from TNFd-containing transcript,indicating that the detection bias toward templates lackingTNFd was introduced mainly by the RT step (43; data not shown).The insertion of TNFd into a PY7 construct, which is splicedefficiently in vitro (20), did not reduce in vitro splicingas compared to the wild-type PY7 in 30- to 90-min reactions(43; data not shown). However, this construct has a very strongPPT (20), which is a central splicing recognition element ofhuman introns, and a putative weak silencing effect of TNFdmay not be revealed. Thus, rigorous evidence for a direct TNFdrole in splicing inhibition will require further studies. TNFdis not a perfect AG repeat since it has two AGGG tetramers bothin the middle and at the 3' end (see Fig. S1 in the supplementalmaterial) that may recruit trans-acting factors that directlycontact A3 in the pre-mRNA or may prevent accessibility of thecryptic 3' ss through secondary structure.

Finally, antisense Alus are amenable to exonization as theycontain a strong PPT and many potential 3' and 5' ss, whereasexonization of sense Alus is less common due to a lack of strongPPT and a lower number of both 3' and 5' ss (44, 57, 58). Sinceantisense Alus contain sequences that inhibit (22, 60) and enhance(H. Lei, I. Day, and I. Vo $r$ echovsk $y$ , submitted for publication)Alu inclusion in mature transcripts, Alu-derived silencers identifiedin this study may contribute to a low exonization potentialof sense Alus. It will be interesting to test this hypothesisin future studies by modifying splicing consensus signals ofnaturally occurring sense Alus in human introns.

ACKNOWLEDGMENTS

This study was supported by grants from the European Commissionand the Wellcome Trust, the Karolinska Institute, and the Universityof Southampton School of Medicine.

We thank C. W. J. Smith, University of Cambridge; G. Screaton,University of Oxford; J. Cáceres, Medical Research CouncilHuman Genetics Unit, Edinburgh; J. Královi $c$ ová,University of Southampton; M. Boutros, DKFZ; S. Marsh and N.Mayor, Anthony Nolan Research Institute, London; and A. Krainer,Cold Spring Harbor Laboratory, for reagents and/or helpful discussions.

FOOTNOTES

* Corresponding author. Mailing address: University of Southampton School of Medicine, Division of Human Genetics, Duthie Building, MP808, Southampton SO16 6YD, United Kingdom. Phone: 44 2380 796425. Fax: 44 2380 794264. E-mail: igvo{at}soton.ac.uk.

Supplemental material for this article may be found at http://mcb.asm.org/.

REFERENCES

Top