This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, B.-H.
Right arrow Articles by Farmer, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, B.-H.
Right arrow Articles by Farmer, S. R.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, October 2004, p. 8671-8680, Vol. 24, No. 19
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.19.8671-8680.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Phosphorylation of C/EBPß at a Consensus Extracellular Signal-Regulated Kinase/Glycogen Synthase Kinase 3 Site Is Required for the Induction of Adiponectin Gene Expression during the Differentiation of Mouse Fibroblasts into Adipocytes

Bae-Hang Park, Li Qiang, and Stephen R. Farmer*

Department of Biochemistry, Boston University School of Medicine, Boston, Massachusetts

Received 22 January 2004/ Returned for modification 18 March 2004/ Accepted 17 June 2004


arrow
ABSTRACT
 
Stimulation of adipogenesis in mouse preadipocytes requires C/EBPß as well as activation of the MEK/extracellular signal-regulated kinase (ERK) signaling pathway. In this study, we demonstrate that phosphorylation of C/EBPß at a consensus ERK/glycogen synthase kinase 3 (GSK3) site regulates adiponectin gene expression during the C/EBPß-facilitated differentiation of mouse fibroblasts into adipocytes. First, we show that exposure of 3T3-L1 preadipocytes to insulin, dexamethasone (DEX), and isobutylmethylxanthine (MIX) leads to the phosphorylation of C/EBPß at threonine 188. Pretreating the cells with a MEK1-specific inhibitor (U0126) significantly attenuates this activity. Similarly, these effectors activate the phosphorylation of T188 within an ectopic C/EBPß overexpressed in Swiss mouse fibroblasts, and this event involves both MEK1 and GSK3 activity. We further show that expression of C/EBPß (p34kD LAP isoform) in Swiss mouse fibroblasts exposed to DEX, MIX, and insulin induces expression of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) and some adiponectin but that it does not activate expression of FABP4/aP2. In fact, complete conversion of these fibroblasts into lipid-laden adipocytes, which includes activation of FABP4 and adiponectin expression, requires their exposure to a potent PPAR{gamma} ligand such as troglitazone. Expression of a mutant C/EBPß in which threonine 188 has been modified to alanine (C/EBPß T188A) can induce PPAR{gamma} production in the mouse fibroblasts, but it is incapable of stimulating adiponectin expression in the absence or presence of troglitazone. Interestingly, replacement of T188 with aspartic acid creates a C/EBPß molecule (C/EBPß T188D) that possesses adipogenic activity similar to that of the wild-type molecule. The absence of adiponectin expression correlates with a reduced amount of C/EBP{alpha} in the adipocytes expressing the T188A mutant suggesting that C/EBP{alpha} is required for expression of adiponectin. In fact, ectopic expression of PPAR{gamma} in C/EBP{alpha}-deficient fibroblasts (NIH 3T3 cells) produces a modest amount of adiponectin, whereas expression of both PPAR{gamma} and C/EBP{alpha} in NIH 3T3 cells facilitates production of abundant quantities of adiponectin. These data demonstrate that phosphorylation of C/EBPß at a consensus ERK/GSK3 site is required for both C/EBP{alpha} and adiponectin gene expression during the differentiation of mouse fibroblasts into adipocytes.


arrow
INTRODUCTION
 
Initiation of adipogenesis in mouse preadipocytes involves the activation of a series of signaling pathways that lead to expression of a cascade of transcription factors regulating production of many hundreds of proteins responsible for the formation of mature adipocytes (22, 31). It is generally accepted that two principal players in this cascade are peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) and C/EBP{alpha} since adipogenesis does not occur in either PPAR{gamma}- or C/EBP{alpha}-deficient mesenchymal stem cells in vivo or in vitro (2, 20, 29, 30). Induction of transcription of these factors during the early phase of adipogenesis is regulated by C/EBPß through association with C/EBP regulatory elements within the promoters of the corresponding genes (8, 28, 37, 41). C/EBPß is a member of the bZIP family of transcription factors that binds to DNA as homodimers or as heterodimers with other C/EBPs. Three isoforms of C/EBPß (38kD, 34kD, and 20kD in mice) are produced to various extents in different cell types and at specific stages of differentiation through alternative use of three translation initiation sites within a single mRNA (1, 6, 9, 39). The most ubiquitous isoform (34kD), usually referred to as LAP (liver-enriched transcriptional activator protein), is composed of a C-terminal region containing the basic DNA-binding and leucine zipper dimerization domains and a N-terminal region, which contains the transactivation domains (10). A larger isoform (38kD), expressed in a differentiation-associated manner in some cell types including preadipocytes, is identical to LAP except that it contains an additional transactivation domain at the N terminus (11, 18, 24). Both LAP and the 38kD protein are potent transactivators of gene expression, whereas the 20kD isoform, LIP (liver-enriched transcriptional inhibitory protein), represses transcription in a dominant negative manner (6, 10, 16, 18). In fact, LIP contains the C-terminal region but lacks the N-terminal transactivation domains and consequently represses transcription through the formation of inactive dimers with LAP (10).

The transcriptional activity of C/EBPß is regulated by several mechanisms, including association with other proteins as well as posttranslational modification. In fact, several reports have suggested a role for phosphorylation in regulating C/EBPß activity in response to a variety of effectors in different cell types (4, 5, 7, 17, 23, 25, 26, 33-35). It has also been suggested that C/EBPß normally exists in a repressed state and is activated by phosphorylation of a repressor domain located between the N-terminal transactivation domains and the C-terminal bZIP region (19). This domain contains several serines and threonines, all of which are phosphorylated to some extent by a constitutive process (3). The site encompassing threonine 188 (SPPGT188PSP) in murine LAP is a consensus site for both glycogen synthase kinase 3 (GSK3) and extracellular signal-regulated kinase (ERK), which is dephosphorylated in response to growth hormone stimulation of preadipocytes (26). Modification of this site by mutation of the threonine to alanine inhibits the C/EBPß-associated transcription of a c-fos promoter reporter in response to growth hormone signaling (25).

We have recently shown that exposure of 3T3-L1 preadipocytes to the adipogenic effectors dexamethasone (DEX), isobutylmethylxanthine (MIX), insulin, and fetal bovine serum (FBS) activates a transient burst of MEK/ERK signaling that coincides with the induction of C/EBPß expression (27). These and other studies have suggested a role for both MEK/ERK signaling and C/EBPß in regulating PPAR{gamma} expression and activity during the early phase of adipogenesis (16). In the present study, we questioned whether the transcriptional activity of C/EBPß is regulated by this differentiation-associated activation of MEK/ERK through the phosphorylation of the consensus ERK/GSK3 site (T188) within the repressor domain of C/EBPß. We demonstrate by using an anti-phospho-Thr188 C/EBPß-specific antibody that effectors which stimulate MEK/ERK signaling in 3T3-L1 preadipocytes also enhance the phosphorylation of T188 in the LAP isoform of C/EBPß. Expression of LAP in Swiss mouse fibroblasts leads to the induction of PPAR{gamma}, which in the presence of a PPAR{gamma} ligand (troglitazone) stimulates the conversion of these cells into fat-laden adipocytes, with a corresponding increase in expression of adipogenic genes, including the adiponectin gene. Expression of a mutant LAP in which T188 has been modified to alanine (LAP T188A) is also capable of inducing expression of PPAR{gamma} and some markers of adipogenesis in response to troglitazone but is significantly less capable of stimulating C/EBP{alpha} and adiponectin gene expression. In addition, ectopic expression of PPAR{gamma} in C/EBP{alpha}-deficient fibroblasts (NIH 3T3 cells) produces a modest amount of adiponectin, whereas expression of both PPAR{gamma} and C/EBP{alpha} in NIH 3T3 cells facilitates production of abundant amounts of the adipocytokine. These data demonstrate that phosphorylation of C/EBPß at a consensus ERK/GSK3 site is required for activation of C/EBP{alpha} expression, which leads to adiponectin gene expression during terminal adipogenesis.


arrow
MATERIALS AND METHODS
 
Reagents. DEX, 3-isobutyl-1-methylxanthine, insulin, aprotinin, LY294002, and Oil Red O were purchased from Sigma (St. Louis, Mo.). Leupeptin and hygromycin were from American Bioanalytical Inc. (Natick, Mass.), while Geneticin, calf serum, and Dulbecco's modified Eagle's medium (DMEM) were supplied by Life Technologies Inc. (Gaithersburg, Md.). FBS was obtained from HyClone (Logan, Utah), [{gamma}-32P]ATP was obtained from Perkin-Elmer Life Sciences (Boston, Mass.), and fibroblast growth factor 2 (FGF-2) was obtained from Peprotech (Rocky Hill, N.J.). Troglitazone was a gift from John Johnson (Parke-Davis/Warner Lambert, Ann Arbor, Mich.).

Antibodies. Polyclonal anti-C/EBP{alpha} and anti-C/EBPß, monoclonal anti-PPAR{gamma}, and polyclonal antiactin were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.). Polyclonal antiadiponectin (ACRP30) was purchased from Affinity Bioreagents (Golden, Colo.), monoclonal anti-pan-ERK was purchased from Transduction Laboratories (Lexington, Ky.), and monoclonal anti-phospho-ERK was purchased from New England Biolabs (Beverly, Mass.). Polyclonal anti-aP2 was kindly provided by David Bernlohr (University of Minnesota). Polyclonal anti-phospho-188Thr-C/EBPß was obtained from Cell Signaling Technology Inc. Polyclonal antiperilipin was a gift from Andy Greenberg, (New England Medical Center, Tufts University, Boston, Mass.).

Expression vectors and generation of stable cell lines. A glutathione S-transferase (GST)-p34C/EBPß (LAP) bacterial expression plasmid was constructed by subcloning PCR products of C/EBPß cDNA (16) into BamHI and EcoRI sites of the pGEX-5X-3 vector (Pharmacia Biotech, Uppsala, Sweden). The LAP PCR fragments were generated with the following primers: 5'GCGGATCCCCACCATGGAAGTGGCCAACTT and 5'CCGGAATTCGCATCAAGTCCCGAAACCCGGT. The mutant forms of C/EBPß (T188A and T188D) were produced by site-directed mutagenesis (QuikChange; Stratagene, La Jolla, Calif.) of the wild-type GST-p34C/EBPß plasmid with the following primers to introduce the appropriate change in codon 188: T188A, 5'TCCAGCCCGCCCGGAGCTCCGAGCCCCGCCGAC3' (new SacI site); T188D, 5'TCCAGCCCGCCCGGGGATCCGAGCCCCGCCGAC3' (new BamHI site). To generate the wild-type and T188A C/EBPß-pRevTRE expression vectors, BamHI-SalI cDNA fragments from the corresponding C/EBPß-pGEX-5X-3 plasmids were subcloned into the pRevTRE plasmid (Clontech, Palo Alto, Calif.) digested with BamHI and SalI. To construct the T188D C/EBPß-pRevTRE expression vector, the corresponding T188D C/EBPß-pGEX-5X-3 plasmid was subjected to controlled partial digestion with BamHI and SalI and the appropriate fragment corresponding to the C/EBPß cDNA was purified by preparative agarose gel electrophoresis. This fragment was subcloned into pGEM-T Easy (Promega, Madison, Wis.) to give rise to the T188D C/EBPß-pGEM-T plasmid. A SalI-SphI fragment of T188D C/EBPß-pGEM-T was subcloned into pRevTRE digested with SalI and SphI. To generate the pRevTRE-C/EBP{alpha} expression vector, a PCR product corresponding to the coding region of C/EBP{alpha} (28) was subcloned into pcDNA 3-1 (–)Myc-His (Invitrogen) following digestion with BamHI and HindIII to give rise to the pcDNA 3-1 (–)Myc-His-C/EBP{alpha} plasmid. The PCR primers used to produce the coding region of C/EBP{alpha} were as follows: 5'CCGGGATCCATGGAGTCGGCCGACTTCTACGA3' and 5'GATCCCAAGCTTCGCGCAGTTGCCCATGGCCTT3'. A BamHI-PmeI fragment of the pcDNA 3-1 (–)Myc-His-C/EBP{alpha} plasmid corresponding to the coding region of C/EBP{alpha} linked to coding sequences for the Myc-His tag was then subcloned into the pRev-TRE plasmid digested with BamHI and HpaI, giving rise to the pRev-TRE-C/EBP{alpha}-Myc-His retroviral expression vector.

To establish retrovirus-producing cell lines, human embryonic kidney 293T cells were seeded at 80% confluence in a 60-mm-diameter dish on the day of transfection. Individual cultures of cells were transfected with Fugene 6 (Roche Biochemicals Inc., Indianapolis, Ind.) and 2 µg of either the wild-type or mutant C/EBPß-pREV-TRE vector, the C/EBP{alpha}-pREV-TRE vector, or pBabe-PPAR{gamma}2, along with 2 µg each of vesicular stomatitis virus G and GP expression plasmids (pVpack; Stratagene). Two days after transfection, culture medium containing high-titer virus was harvested and filtered through a 0.45-µm-pore-size filter. The viral filtrate supernatant was used to infect Swiss mouse 3T3 fibroblasts constitutively expressing the TET activator protein (Swiss TET-off cells; Clontech) or NIH 3T3 cells that were seeded in a 60-mm dish at 25% confluence on the day of infection. Cells were incubated with retrovirus overnight in the presence of 4 µg of Polybrene (Sigma)/ml, and the infection was allowed to proceed for an additional 2 days in fresh growth medium. At this stage, 100 µg of hygromycin and/or puromycin/ml was added to facilitate selection of stable cell lines, which required culture for 2 to 3 weeks in the presence of the antibiotic.

Cell culture. 3T3-L1 preadipocytes were grown in growth medium (DMEM containing 10% calf serum) until confluent and were then maintained in the same medium for an additional 2 to 3 days. Stimulation of the various signaling pathways was induced at 2 to 3 days postconfluence by addition of 1 µM DEX, 0.5 mM MIX, 1.67 µM insulin, 10% FBS, and 1 nM FGF-2. Swiss TET-off cells were maintained in growth medium (DMEM containing 10% FBS) with 100 µg of Geneticin/ml and 1 µg of tetracycline/ml. Swiss TET-off cells expressing either wild-type or mutant C/EBPß (Swiss-LAP cells) were maintained in the same growth medium as the Swiss TET-off cells except that 100 µg of hygromycin/ml was also included along with the other antibiotics listed above. Differentiation of the Swiss-LAP and NIH-PPAR{gamma} ± C/EBP{alpha} cell lines was essentially as described previously (13, 16, 21). Cells were plated and cultured without tetracycline for 2 days until they reached confluence. Differentiation was induced at 2 days postconfluence (day 0) by adding fresh DMEM containing 10% FBS, 0.5 mM MIX, 1 µM DEX, 1.67 µM insulin, and 10 µM troglitazone. After 48 h, cells were maintained in DMEM with 10% FBS, 0.83 µM insulin, and 10 µM troglitazone. For experiments with U0126 (10 µM), LY294002 (50 µM), or LiCl (10 mM), postconfluent cells were preincubated with each of the drugs for 30 min prior to addition of other effectors. Oil Red O staining was performed by following the procedure described previously (38). The cells were then photographed by phase-contrast microscopy.

Preparation of whole-cell and nuclear extracts. Cultured cells were rinsed with phosphate-buffered saline (140 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 8.1 mM Na2HPO4 [pH 7.4]). For whole-cell extracts, cells were harvested in ice-cold extraction buffer (20 mM Tris [pH 7.4], 150 mM NaCl, 0.5% sodium deoxycholate, 2% Nonidet P-40, 0.2% sodium dodecyl sulfate, 1 mM EDTA, 20 mM NaF, 30 mM tetrasodium pyrophosphate, 1 mM dithiothreitol, 1 mM sodium vanadate, 10% glycerol, 5 µM aprotinin, 50 µM leupeptin, 1 mM phenylmethylsulfonyl fluoride [PMSF]) and lysates were incubated on ice for 15 min and then centrifuged at 18,000 x g. For nuclear protein extracts, cells were lysed in lysis buffer (10 mM Tris [pH 7.6], 10 mM NaCl, 3 mM MgCl2, 0.5% Nonidet P-40). After a low-speed centrifugation, nuclei were resuspended in nuclear extraction buffer (20 mM HEPES [pH 7.9], 350 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA [pH 8.0], 25% glycerol, 5 µM aprotinin, 50 µM leupeptin, 1 mM PMSF) and then incubated on ice for 20 min and centrifuged at full speed (13,000 rpm) at 4°C. The resulting supernatants were stored at –80°C, and protein concentrations were determined with the bicinchoninic acid kit (Pierce, Rockford, Ill.).

Gel electrophoresis and immunoblotting. Proteins were analyzed by sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (NEN Life Science, Boston, Mass.) in 25 mM Tris-192 mM glycine. Following transfer, membranes were blocked with 4% nonfat dry milk in phosphate-buffered saline-0.1% Tween 20 and probed with the antibodies specified above. Horseradish peroxidase-conjugated secondary antibodies (Sigma) and an enhanced chemiluminescence (ECL) substrate kit (Perkin-Elmer Life Science) were used for detection of specific proteins.

Electrophoretic mobility shift assay (EMSA). DNA binding assays were performed on nuclear extracts prepared from wild-type, T188A, and T188D Swiss-LAP cells by following previously described procedures (15, 28). A double-stranded oligonucleotide corresponding to the C/EBP response element within the C/EBP{alpha} promoter (5'GATCCGCGTTGCGCCACGATG3') was end labeled with [{gamma}-32P]ATP by using T4 polynucleotide kinase according to the manufacturer's instructions (New England Biolabs). For supershift analysis, 3 µg of nuclear protein extract was incubated with antibodies at room temperature for 30 min prior to the binding reaction. Each nuclear extract was incubated with 2 µg of poly(dI-dC), 10x binding buffer (100 mM Tris-Cl [pH 7.5], 500 mM NaCl, 10 mM EDTA, 10 mM dithiothreitol, 50% glycerol), 1.5 µl of 50% glycerol, and 10,000 cpm of radiolabeled oligonucleotide in a final volume of 20 µl at room temperature for 30 min. The reaction mixtures were resolved on a nondenaturing 6% polyacrylamide (39:0.5, acrylamide/bisacrylamide) gel at 150 V for 4 h at 4°C in running buffer (25 mM Tris [pH 8.3], 190 mM glycine, 1 mM EDTA, 10% glycerol). Gels were vacuum dried for 1 h before exposure to Biomax MR-1 autoradiography film (Eastman Kodak Co.). Antibodies used for the supershifts were anti-C/EBPß and anti-C/EBP{alpha}, as described above.


arrow
RESULTS
 
Activation of MEK/ERK signaling during the early phase of adipogenesis leads to the phosphorylation of C/EBPß. To measure the phosphorylation of C/EBPß during the differentiation of preadipocytes, we employed a phospho-C/EBPß-specific antibody, which was produced against a phosphorylated peptide corresponding to the site encompassing threonine 188 of murine C/EBPß. Figure 1A demonstrates that exposure of confluent 3T3-L1 preadipocytes to DEX, MIX, insulin, and FBS induces MEK1 activity during the initial 60 min of differentiation, as indicated by the phosphorylation of ERK1 and ERK2, which precedes the phosphorylation of C/EBPß occurring between 1 and 2 h after the start of differentiation. The activation of MEK1 is short-lived since it subsides to quiescent levels by 6 h, whereas C/EBPß phosphorylation can be detected throughout the first 2 days of adipogenesis. Following these early events, the preadipocytes continue to differentiate into mature adipocytes, as indicated by the sequential expression of the adipogenic genes including the C/EBPß, PPAR{gamma}, C/EBP{alpha}, perilipin, and adiponectin genes. This pattern of signaling, in which activation of MEK1 immediately precedes phosphorylation of C/EBPß, suggests that MEK1 might regulate C/EBPß activity during adipogenesis. To determine whether MEK1 phosphorylates C/EBPß in 3T3-L1 preadipocytes, we exposed confluent cells to DEX and MIX in the presence or absence of FGF-2 and/or insulin for 4 h and a Western blot analysis was performed on total cellular proteins. Our previous studies have shown that FGF-2 is a potent inducer of MEK1 activity in 3T3-L1 cells and is a proadipogenic factor; consequently, we employed this effector to enhance the phosphorylation of C/EBPß. Figure 1B demonstrates that the phospho-C/EBPß antibody detects a protein that comigrates with the LAP isoform of C/EBPß in cells exposed to DEX and MIX (lane 1). These conditions also lead to the activation of MEK1, as revealed by the phosphorylation of both ERK1 and ERK2. Exposure of the cells to insulin and FGF-2 enhances the phosphorylation of both C/EBPß and the ERKs (Fig. 1B, lane 3), whereas exposure to insulin without FGF-2 attenuates the expression of the phospho-C/EBPß species (Fig. 1B, lane 2). Inhibition of MEK1 activity by exposure of the cells to U0126 blocked the phosphorylation of C/EBPß by FGF-2 and insulin (Fig. 1, lane 4). Additionally, insulin, which activates both phosphatidylinositol (PI)-3 kinase and Akt/protein kinase B activity and leads to suppression of GSK3 activity, attenuates phosphorylation of C/EBPß. Treatment of the cells with LY294002, an inhibitor of PI-3 kinase activity, potentiates the ability of FGF-2 to phosphorylate C/EBPß (Fig. 1B, lane 5), while treatment with LiCl, an inhibitor of GSK3 activity, attenuated this effect of FGF-2. Taken together, the data presented in Fig. 1 demonstrate that activation of MEK1/ERK and/or GSK3 signaling potentiates the phosphorylation of threonine 188 within the LAP isoform of C/EBPß during the initial stages of adipogenesis in 3T3-L1 preadipocytes.




View larger version (111K):
[in this window]
[in a new window]
 
FIG. 1. Phosphorylation of C/EBPß at a consensus ERK/GSK3 site during the differentiation of 3T3-L1 preadipocytes. (A) Proliferating 3T3-L1 preadipocytes were cultured in growth medium until they reached confluence. At 2 days postconfluence (day 0), the quiescent cells were exposed to DEX, MIX, FBS, and insulin, and total cellular protein was harvested at the indicated times. Equal amounts of protein from each sample were subjected to Western blot analysis using antibodies specific for phospho-ERK1/2 (p-ERK), phospho-C/EBPß (p-C/EBPß), ERK, C/EBPß, PPAR{gamma}, C/EBP{alpha}, perilipin, and adiponectin. (B) Confluent 3T3-L1 preadipocytes were exposed to various combinations of 1.67 µM insulin (I), 1 nM FGF-2 (F), 20 µM U0126 (U), 50 µM LY294002 (LY), and 10 mM LiCl (Li) in the presence of MIX and DEX for 4 h, and total cellular protein was subjected to Western blot analysis using antibodies specific for phospho-C/EBPß (pC/EBPß), C/EBPß, phospho-ERK1/2 (pERK), and ERK.

Activation of ERK or GSK3 in mouse embryo fibroblasts induces the phosphorylation of C/EBPß on Thr188. To investigate the role of threonine 188 in regulating C/EBPß activity, we generated expression vectors corresponding to the LAP isoform of C/EBPß (wild type) as well as two mutant proteins in which threonine 188 was replaced by either alanine (T188A) or aspartic acid (T188D). To identify the signaling pathways regulating the phosphorylation of C/EBPß in vivo, we ectopically expressed wild-type LAP and the corresponding T188A and T188D mutant proteins in Swiss mouse fibroblasts using the pRevTET-off expression system. Figure 2A shows an extensive phosphorylation of the wild-type protein in cells exposed to insulin in the presence of MIX and DEX, as revealed by detection of a phosphorylated protein on the Western blot with the phospho-C/EBPß-specific antibody (Fig. 2A, lane 1). The extent of phosphorylation is enhanced when cells are exposed to FGF-2 along with the other effectors (Fig. 2A, lane 2), which also stimulates MEK activity (phosphorylation of ERK). In fact, inhibition of MEK1 by exposure of the cells to U0126 dramatically attenuates the phosphorylation of C/EBPß (Fig. 2A, lane 4). As observed in Fig. 1 for the endogenous C/EBPß in 3T3-L1 preadipocytes, inhibition of PI-3 kinase with LY294002appears to enhance the ability of FGF-2 to induce C/EBPß phosphorylation (Fig. 2A, lane 3), and this activity is also blocked by treatment of the cells with LiCl (Fig. 2A, lane 5). We also expressed the T188A and T188D mutant C/EBPßs and compared their levels of phosphorylation with that of the wild-type control using the anti-phospho-C/EBPß antibody (Fig. 2B). As expected, these data show that the antibody does not interact with the mutant proteins on Western blots since they do not contain a threonine to act as an acceptor for phosphate in the Swiss cells. The significance of this analysis is that it demonstrates the specificity of the antibody for phospho-T188 within C/EBPß and, along with the data in Fig. 2A, confirms that T188 is a target of ERK/GSK3 signaling in Swiss mouse fibroblasts.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 2. Phosphorylation of T188 within a consensus ERK/GSK3 site of an ectopic C/EBPß in response to exposure of Swiss mouse fibroblasts to FGF-2. Swiss mouse fibroblasts expressing either wild-type (Wt), T188A (T-A), or T188D (T-D) forms of C/EBPß were cultured in growth medium without tetracycline until confluent. Two days later, the cells were exposed to the various effectors in the presence of MIX, DEX, and insulin. (A) The Wt cells were exposed to various combinations of 1 nM FGF-2, 20 µM U0126 (U), 50 µM LY294002 (LY), and 10 mM LiCl (Li) for 30 min and harvested, and the resulting total cell proteins were subjected to Western blot analysis of phospho-C/EBPß (pC/EBPß), C/EBPß, phospho-ERK (pERK), and ERK. (B) Confluent Wt, T-A, and T-D cells were exposed to 1 nM FGF-2 along with DEX, MIX, and insulin for 30 min, and total cell proteins were subjected to Western blot analysis of phospho-C/EBPß and C/EBPß.

Ectopic expression of wild-type, T188A, and T188D forms of C/EBPß in Swiss mouse fibroblasts induces accumulation of lipids and morphological differentiation into adipocytic cells. Our earlier studies have shown that ectopic expression of C/EBPß in NIH 3T3 fibroblasts induces expression of PPAR{gamma}, which, in response to an exogenous PPAR{gamma} ligand, leads to lipogenesis and expression of some adipogenic genes, most notably the gene encoding adipose tissue-specific fatty acid binding protein aP2 (36-38). Other adipogenic genes such as the C/EBP{alpha} and GLUT4 genes are not expressed; consequently, we chose to investigate the function of C/EBPß in Swiss mouse fibroblasts, which are more likely to differentiate into mature adipocytes expressing the full complement of adipocyte genes (13). To determine the role of phosphorylation in regulating the adipogenic activity of C/EBPß, we ectopically expressed LAP and its corresponding ERK/GSK3 site mutant proteins (T188A and T188D) in fibroblasts by culturing the corresponding Swiss-LAP cells (wild type and mutants) for several days in the presence or absence of tetracycline. Confluent cells were then exposed to DEX, MIX, insulin, and troglitazone in the presence or absence of tetracycline. Figure 3 demonstrates that all three cell lines, when cultured in the absence of tetracycline, are capable of undergoing an extensive morphological differentiation, as revealed by the formation of large round cells filled with lipid droplets. It appears that the wild-type cells accumulate more lipid than the T188A mutants even though the latter adopt a round morphology. Culture in the presence of tetracycline to prevent the ectopic expression of the LAP proteins results in maintenance of the original fibroblast morphology throughout the differentiation period.



View larger version (102K):
[in this window]
[in a new window]
 
FIG. 3. Morphological differentiation of Swiss mouse fibroblasts expressing wild type (Wt), T188A (TA), and T188D (TD) forms of C/EBPß. The Swiss cell lines corresponding to Wt, TA, and TD forms of C/EBPß were induced to differentiate for 5 days in the absence or presence of tetracycline (TET), as described in Materials and Methods. The cells were then fixed, stained with Oil Red O, and photographed.

Phosphorylation of C/EBPß at the ERK/GSK3 site is required for its ability to induce adiponectin gene expression. To determine whether these mutant C/EBPs have different effects on adipogenic gene expression, the corresponding Swiss-LAP cells were exposed to DEX and insulin with or without MIX or troglitazone for 5 days and expression of the adipogenic program was assessed by analysis of total cell proteins on Western blots. Exposure of the wild-type cells to DEX and insulin alone in the absence of tetracycline facilitates phosphorylation of the ectopic C/EBPß and induces expression of PPAR{gamma}2 but is incapable of stimulating adipogenesis (Fig. 4, lane 1). Addition of MIX along with DEX and insulin not only causes phosphorylation of C/EBPß and expression of PPAR{gamma}2 but also induces production of adiponectin and perilipin (Fig. 4, lane 4). Interestingly, these conditions are incapable of activating aP2 expression to any significant extent (Fig. 4, lane 4). Activation of PPAR{gamma} activity by troglitazone, however, induces aP2 expression and enhances production of the other adipogenic genes (Fig. 4, lane 7). Culture of the T188A mutant cell line in the absence of tetracycline induces abundant expression of C/EBPß equivalent to the levels produced in the wild-type cells and under all the conditions analyzed is capable of inducing PPAR{gamma}2 expression (Fig. 4, lanes 2, 5, and 8). Interestingly, the mutant LAP protein (T188A) in these fibroblasts is not capable of stimulating adiponectin expression to any significant extent compared to wild-type LAP, even in the presence of troglitazone (Fig. 4, compare lanes 5 and 8 with 4 and 7, respectively). Cells that express the T188A protein, however, are capable of synthesizing perilipin and aP2 following exposure to troglitazone. It is noteworthy that the T188D C/EBPß expresses a significantly higher level of adipogenic activity than the T188A mutant protein but not as high a level as the WT protein. This is due, presumably, to the presence of the negatively charged aspartic acid, which mimics the effect of the phosphorylated threonine 188.



View larger version (72K):
[in this window]
[in a new window]
 
FIG. 4. Phosphorylation of mouse C/EBPß at a consensus ERK/GSK3 site (T188) is required for the induction of adiponectin gene expression during the differentiation of mouse fibroblasts. Swiss mouse fibroblast cell lines (wild type [Wt], T188A [T-A], and T188D [T-D]) were grown to confluence in the absence of tetracycline to induce expression of the corresponding C/EBPß protein. Two days later, the cells were treated with either MIX or troglitazone in the presence of DEX and insulin. The cells were harvested 5 days later and subjected to Western blot analysis of phospho-C/EBPß (phosC/EBPß), C/EBPß, PPAR{gamma}, perilipin, adiponectin, aP2, and actin.

Phosphorylation of C/EBPß at T188 is required to induce expression of C/EBP{alpha} as well as adiponectin. To define the role of phospho-C/EBPß in regulating adipogenesis, we analyzed the sequential expression of selected adipogenic proteins during the differentiation of wild-type, T188A, and T188D cell lines. Figure 5A demonstrates that exposure of the cells to DEX, MIX, insulin, and troglitazone in the absence of tetracycline leads to an increase in the ectopic C/EBPß proteins within the initial 24 h, which reaches a maximum of expression by day 3 and remains at these high levels throughout the 7-day culture period. All three cell lines express approximately the same amount of C/EBPß. PPAR{gamma} expression is induced within the initial 1 to 3 days of differentiation and is significantly more apparent at this time in the wild-type and T188D cells than in the T188A cell line. By day 5, it appears that all three cell lines express equivalent quantities of PPAR{gamma}. This is in contrast to the expression of C/EBP{alpha}, which is abundantly expressed in wild-type and T188D cells but which is virtually absent in cells expressing the T188A mutant protein.



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 5. Phosphorylation of mouse C/EBPß at a consensus ERK/GSK3 site (T188) is required for C/EBP{alpha} expression and for sustaining terminal adipogenesis. (A) Swiss mouse fibroblast cell lines (wild type [WT], T188A [T-A], and T188D [T-D]) were cultured in growth medium with or without tetracycline until confluent. Two days later, the cells were induced to differentiate by exposure to DEX, MIX, FBS, insulin, and troglitazone for 2 days in the absence or presence of tetracycline. At this stage, cells were treated with insulin and troglitazone in the presence (7d+TET) or absence of tetracycline and harvested at the indicated times. (B) The Swiss-LAP cells (WT, T-A, or T-D) were induced to differentiate in the absence of tetracycline for 6 days as outlined for panel A. At this stage, 1 µg of tetracycline (+) or vehicle (–) was added to the culture medium of each cell line to suppress expression of the ectopic C/EBPß, and cells were harvested for nuclear proteins at the indicated times. Equal amounts of nuclear proteins from each cell sample (A and B) were subjected to Western blot analysis of C/EBPß, PPAR{gamma}, and C/EBP{alpha}.

The data in Fig. 5A suggest that phosphorylation of C/EBPß is also required to facilitate expression of C/EBP{alpha} in response to activation of PPAR{gamma}. It is also possible that the T188A mutant C/EBPß acts as a dominant negative factor which blocks C/EBP{alpha} expression. To investigate this possibility, differentiation was induced in three cell lines for 6 days as outlined in Fig. 5A in order to facilitate induction of PPAR{gamma} and then ectopic C/EBPß expression was inhibited by treating the cultures with tetracycline. Figure 5B shows a Western blot analysis of proteins isolated from the cells treated with or without tetracycline for increasing times following the 6-day time period. Addition of tetracycline results in an extensive decrease in expression of the ectopic C/EBPß in all three cell lines compared to the levels of expression in cells maintained in the absence of tetracycline (Fig. 5B, compare lanes 2, 4, 6, 8, 10, 12, 14, 16, and 18 with 1, 3, 5, 7, 9, 11, 13, 15, and 17). In the wild-type and T188D cells, the decrease in C/EBPß expression had no effect on the abundant expression of PPAR{gamma} or C/EBP{alpha} during the 3 days of exposure to tetracycline (Fig. 5B, lanes 2, 4, 6, 14, 16, and 18). These data suggest that, once the ectopic C/EBPß (wild type or T188D) has established an adipogenic state by inducing PPAR{gamma} and C/EBP{alpha}, the adipogenic program is self-sustaining, probably as a result of the cross-regulation of PPAR{gamma} and C/EBP{alpha}. In contrast, suppression of the T188A mutant C/EBPß at day 6 results in a corresponding down-regulation of PPAR{gamma} expression and a decrease in the already low levels of C/EBP{alpha} (Fig. 5B, lanes 8, 10, and 12). It appears, therefore, that the T188A C/EBPß is not acting as a dominant negative molecule but instead is incapable of producing the quantity of C/EBP{alpha} required to maintain PPAR{gamma} expression during terminal adipogenesis.

Mutant C/EBPß T188A can bind to a C/EBP response element from the proximal promoter of the C/EBP{alpha} gene. To determine whether the inability of C/EBPß T188A to stimulate C/EBP{alpha} expression stems from its inability to bind to the C/EBP response element within the proximal promoter of the C/EBP{alpha} gene, we compared the DNA binding activities of wild-type, T188A, and T188D proteins to a radiolabeled oligonucleotide corresponding to the response element (GCGTTGCGCCACGATG; the response element is underlined). The EMSA presented in Fig. 6A demonstrates that all three proteins expressed in cells that had been differentiated for 5 days avidly bind to the radiolabeled oligonucleotide (lanes 1, 5, and 9), giving rise to several distinct DNA-protein complexes. It is noteworthy that the profile of complexes in the T188A EMSA differs somewhat from those in the wild-type and T188D EMSAs (Fig. 6A, compare lane 5 with 1 and 9). A supershift EMSA using an anti-C/EBPß antibody confirms that all of these complexes contain C/EBPß and also demonstrates that the T188A C/EBPß is as efficient at forming these complexes as the wild-type and T188D proteins. As expected, the abundance of C/EBP{alpha}-containing complexes in the T188A cells is significantly lower than that in wild-type or T188D cells, as revealed by the supershift EMSA using an anti-C/EBP{alpha} antibody (Fig. 6A, compare lane 7 with 3 and 11). The supershift EMSA presented in Fig. 6B further shows that the T188A C/EBPß binds to the C/EBP response element as avidly as the wild-type protein throughout the differentiation process (compare lanes 5 to 8 with 1 to 4). In contrast, as observed in Fig. 6A, the abundance of the complexes containing C/EBP{alpha} in the T188A cells is significantly lower than that in wild-type cells, consistent with the significantly lower level of expression of the C/EBP{alpha} protein in the T188A cells (Fig. 5).



View larger version (60K):
[in this window]
[in a new window]
 
FIG. 6. Phosphorylation of C/EBPß at T188 is not required for its ability to bind to a C/EBP regulatory element from the promoter of the C/EBP{alpha} gene. Swiss fibroblasts expressing wild-type (WT), T188A (T-A), or T188D (T-D) forms of C/EBPß were induced to differentiate as described for Fig. 5A, and cells were harvested at either day 7 (A) or the indicated times (B) for preparation of nuclear extracts. Equal amounts of each extract were preincubated for 30 min in the presence or absence of antiserum for either C/EBPß (Cßa/b) or C/EBP{alpha} (C{alpha}a/b) or a 100-fold excess of cold C/EBP-oligonucleotide (C/EBP binding site in the C/EBP{alpha} promoter) prior to addition of a 32P-labeled C/EBP-oligonucleotide. The binding of the oligonucleotide to the different C/EBP complexes was analyzed by EMSA, as described in Materials and Methods. Arrowheads, corresponding supershifted complexes.

Induction of adiponectin expression by PPAR{gamma} in mouse fibroblasts requires C/EBP{alpha}. The data presented above suggested that the inability of the T188A mutant protein to activate adiponectin expression in mouse fibroblasts results from its inability to induce expression of C/EBP{alpha}. To investigate the role of C/EBP{alpha} in regulating adiponectin expression, we generated mouse fibroblasts expressing PPAR{gamma} with or without C/EBP{alpha} by infecting NIH 3T3 cells (C/EBP{alpha} deficient) with retroviral vectors to facilitate expression of C/EBP{alpha} and/or PPAR{gamma} (i.e., NIH 3T3-P{gamma}+/C{alpha}– [C{alpha}–] and NIH 3T3-P{gamma}+/C{alpha}+ [C{alpha}+]). Each cell line was induced to differentiate by exposure to DEX, MIX, insulin, and troglitazone, and total cell proteins prepared at different times were analyzed on Western blots. Figure 7 shows the constitutive expression of PPAR{gamma}2 in both cell lines (C{alpha}– and C{alpha}+) and the absence of C/EBP{alpha} in the C{alpha}– cell line. Figure 7 also shows an extensive induction of fatty acid synthase and aP2 expression following exposure of both cell lines to the adipogenic inducers. In contrast, adiponectin expression is activated to a significant extent only in the NIH 3T3 fibroblasts expressing both PPAR{gamma}2 and C/EBP{alpha} (Fig. 7, compare lanes 6 and 7).



View larger version (68K):
[in this window]
[in a new window]
 
FIG. 7. Induction of adiponectin expression in mouse fibroblasts by PPAR{gamma}2 requires expression of C/EBP{alpha}. Confluent NIH 3T3 cell lines expressing PPAR{gamma}2 with (+C/EBP{alpha}) or without (–C/EBP{alpha}) were induced to differentiate by exposure to DEX, MIX, FBS, insulin, and troglitazone. At day 2, cells were treated with insulin and troglitazone and harvested at the indicated times for Western blot analysis of PPAR{gamma}2, C/EBP{alpha}, adiponectin, fatty acid synthase (FAS), aP2, and ß-catenin. Noninfected NIH 3T3 fibroblasts were also subjected to the same differentiation protocol for 6 days in order to illustrate the absence of adipogenic proteins.


arrow
DISCUSSION
 
In this report, we demonstrate that phosphorylation of the LAP isoform of C/EBPß at a consensus ERK/GSK3 site regulates adiponectin gene expression during the C/EBPß-facilitated differentiation of mouse fibroblasts into adipocytes. The data show that conditional ectopic expression of a mutant form of LAP in which threonine 188 has been replaced with alanine (T188A) is incapable of stimulating adiponectin gene expression, whereas wild-type LAP and a T188D mutant protein express this activity. Phosphorylation of T188 within the consensus ERK/GSK site is likely regulated by proadipogenic effectors by stimulating MEK1 activity during the early phase of adipogenesis in mouse preadipocytes or fibroblasts ectopically expressing C/EBPß. The inability of the T188A mutant protein to induce adiponectin expression appears to be due to its inability to stimulate C/EBP{alpha} expression. Consistent with this notion is the fact that PPAR{gamma}2 is capable of stimulating adiponectin expression to a significant extent only in fibroblasts that also express C/EBP{alpha}. This finding is in agreement with a recent study suggesting a role for C/EBP{alpha} in regulating adiponectin expression in mouse embryo fibroblasts (14).

Identification of T188 in LAP as a target for phosphorylation by ERK and GSK3 in response to exposure of fibroblasts to adipogenic effectors. The data demonstrate that threonine 188 of the LAP isoform of murine C/EBPß is a target of ERK and GSK3 in vivo (Fig. 2) as well as in vitro (data not shown). Threonine 188 is located within a domain of LAP that contains several serine and threonine residues that are potential targets for phosphorylation. In fact, a recent study has demonstrated that most of these residues are phosphorylated to some extent by constitutive signaling pathways (3). The studies presented in Fig. 2A that suggest that both ERK and GSK3 can phosphorylate LAP on T188 in response to exposure of mouse fibroblasts to FGF-2 are based on the use of an anti-phospho-C/EBPß antibody to detect phosphorylated C/EBPß. The specificity of this antibody for phosphorylated T188 is presented in Fig. 2B, which shows that, in contrast to the wild-type LAP protein, the T188A and T188D mutant proteins do not react with the antibody on Western blots. It appears from the data in Fig. 2A that FGF-2 stimulates the phosphorylation of LAP through at least two separate signaling pathways. The use of U0126 suggests that MEK1/ERK signaling is involved, and the use of both LiCl to block GSK3 and LY294002 to potentially enhance GSK3 activity by attenuating PI-3 kinase/Akt activity supports the involvement of a PI-3 kinase/GSK3 pathway.

Role of T188 in regulating the adipogenic activity of C/EBPß. The direct involvement of T188 in regulating the adipogenic activity of C/EBPß is clearly demonstrated in Fig. 4. Conditional ectopic expression of LAP in nonadipogenic mouse fibroblasts induces PPAR{gamma} expression and under specified adipogenic conditions also facilitates conversion of these cells into mature adipocytes based on the accumulation of lipid droplets and expression of adiponectin, perilipin, and FABP4 (aP2). Ectopic expression of the LAP T188A mutant protein in the mouse cells can also stimulate expression of the PPAR{gamma} gene and some other adipocyte genes, but it is incapable of inducing adiponectin gene expression. In contrast, the LAP T188D mutant protein expresses a level of adipogenic activity which approaches that of the normal LAP protein. These observations suggest that phosphorylation of C/EBPß by ERK and/or GSK3 in response to extracellular effectors regulates its adipogenic activity, which includes coordinating the expression of the full complement of genes during terminal adipogenesis, most notably adiponectin. Previous studies by us have shown a positive role for the activation of MEK/ERK signaling during the early phase of adipogenesis in 3T3-L1 preadipocytes (27). Specifically, we demonstrated that inhibition of MEK1 activity with U0126 blocked the expression of PPAR{gamma} and C/EBP{alpha} in 3T3-L1 preadipocytes and, consequently, prevented the differentiation of these cells into mature adipocytes. The studies presented above, however, demonstrate that preventing the phosphorylation of the consensus ERK/GSK3 domain within C/EBPß during the differentiation of mouse fibroblasts has a much more selective effect on adipogenic gene expression since induction of PPAR{gamma}, perilipin, and aP2 expression occurred in the T188A mutant cells. It is likely that phosphorylation of C/EBPß is only one of several transcriptional processes that is regulated by MEK/ERK signaling during the early phase of adipogenesis. In fact, recent studies have suggested that clonal expansion, which is required for terminal adipogenesis, is also regulated by MEK/ERK signaling (32).

What is the mechanism by which phosphorylation of C/EBPß selectively regulates adipogenic gene expression? It appears from the data in Fig. 4 that the T188A mutant C/EBPß is as capable of activating PPAR{gamma} expression as the wild-type protein in the corresponding Swiss cells following exposure to DEX and insulin with or without MIX or troglitazone. In contrast, the mutant protein is not as effective at inducing C/EBP{alpha} expression when cells are exposed to the adipogenic inducers, including troglitazone (Fig. 5). This effect does not appear to be due to any significant decrease in the ability of the T188A C/EBPß to bind to a C/EBP regulatory element located in the minimal promoter of the C/EBP{alpha} gene (Fig. 6). It is possible, however, that the phosphorylation-defective C/EBPß may recruit corepressors to the C/EBP{alpha} gene and not the PPAR{gamma} gene. Recent studies have suggested that the transcriptional regulation of the PPAR{gamma} gene by C/EBPs differs from that of other C/EBP target genes. In fact, the C/EBP response element within the proximal promoter of the PPAR{gamma}2 gene does not conform to the usual consensus sequence (12). The element consists of two overlapping sequences that direct the interaction of C/EBP with nuclear factor of activated T cells (NFAT) to form an enhancer complex responsible for NFAT-mediated activation of PPAR{gamma}2 gene transcription (40). It is conceivable, therefore, that phosphorylation of T188 of C/EBPß is not required for the formation of this unique enhancer complex. In contrast, however, the C/EBP regulatory element within the C/EBP{alpha} promoter conforms to a consensus sequence similar to that present in many other C/EBP target genes. Furthermore, studies have shown that C/EBPß and C/EBP{alpha} are potent activators of C/EBP{alpha} gene transcription through direct interaction with this response element in the proximal promoter. The data presented above are consistent, therefore, with the notion that the unphosphorylated form of C/EBPß (T188A) is incapable of activating C/EBP{alpha} transcription. It follows that the absence of C/EBP{alpha} is responsible for the lack of adiponectin expression since the studies shown in Fig. 7 clearly demonstrate that expression of adiponectin during adipogenesis depends on C/EBP{alpha} expression.

In conclusion, these studies identify an important role for phosphorylation of C/EBPß at a consensus ERK/GSK3 site in regulating the expression of adiponectin during adipogenesis. The model presented in Fig. 8 illustrates a signaling pathway leading to adiponectin which includes phosphorylation of C/EBPß and activation of C/EBP{alpha}. It is likely that this pathway also requires activation of PPAR{gamma} since terminal adipogenesis depends on PPAR{gamma} activity. These observations, however, raise the possibility of identifying targets that may facilitate modulation of adiponectin expression without affecting other features of adipocyte function. For instance, promoting phosphorylation of C/EBPß in insulin-resistant adipocytes may enhance secretion of adiponectin without increasing accumulation of lipid and, in so doing, may be an effective therapy for metabolic syndrome.



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 8. Transcription factors and signaling pathways regulating adiponectin expression during adipogenesis. This model is based on this study and other studies referred to in the text.


arrow
ACKNOWLEDGMENTS
 
This work was supported by USPHS grants DK51586 and DK58825.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry, Boston University School of Medicine, 715 Albany St., Boston, MA 02118. Phone: (617) 638-4186. Fax: (617) 638-5339. E-mail: farmer{at}biochem.bumc.bu.edu. Back


arrow
REFERENCES
 
    1
  1. An, M. R., C. C. Hsieh, P. D. Reisner, J. P. Rabek, S. G. Scott, D. T. Kuninger, and J. Papaconstantinou. 1996. Evidence for posttranscriptional regulation of C/EBP{alpha} and C/EBPß isoform expression during the lipopolysaccharide-mediated acute-phase response. Mol. Cell. Biol. 16:2295-2306.[Abstract]
  2. 2
  3. Barak, Y., M. C. Nelson, E. S. Ong, Y. Z. Jones, P. Ruiz-Lozano, K. R. Chien, A. Koder, and R. M. Evans. 1999. PPAR{gamma} is required for placental, cardiac, and adipose tissue development. Mol. Cell 4:585-595.[CrossRef][Medline]
  4. 3
  5. Bradley, M. N., L. Zhou, and S. T. Smale. 2003. C/EBPß regulation in lipopolysaccharide-stimulated macrophages. Mol. Cell. Biol. 23:4841-4858.[Abstract/Free Full Text]
  6. 4
  7. Buck, M., V. Poli, T. Hunter, and M. Chojkier. 2001. C/EBPß phosphorylation by RSK creates a functional XEXD caspase inhibitory box critical for cell survival. Mol. Cell 8:807-816.[CrossRef][Medline]
  8. 5
  9. Buck, M., V. Poli, P. van der Geer, M. Chojkier, and T. Hunter. 1999. Phosphorylation of rat serine 105 or mouse threonine 217 in C/EBP beta is required for hepatocyte proliferation induced by TGF{alpha}. Mol. Cell 4:1087-1092.[CrossRef][Medline]
  10. 6
  11. Calkhoven, C. F., C. Muller, and A. Leutz. 2000. Translational control of C/EBP{alpha} and C/EBPß isoform expression. Genes Dev. 14:1920-1932.[Abstract/Free Full Text]
  12. 7
  13. Chinery, R., J. A. Brockman, D. T. Dransfield, and R. J. Coffey. 1997. Antioxidant-induced nuclear translocation of CCAAT/enhancer-binding protein ß. A critical role for protein kinase A-mediated phosphorylation of Ser299. J. Biol. Chem. 272:30356-30361.[Abstract/Free Full Text]
  14. 8
  15. Clarke, S. L., C. E. Robinson, and J. M. Gimble. 1997. CAAT/enhancer binding proteins directly modulate transcription from the peroxisome proliferator-activated receptor {gamma}2 promoter. Biochem. Biophys. Res. Commun. 240:99-103.[CrossRef][Medline]
  16. 9
  17. Darlington, G. J., S. E. Ross, and O. A. MacDougald. 1998. The role of C/EBP genes in adipocyte differentiation. J. Biol. Chem. 273:30057-30060.[Free Full Text]
  18. 10
  19. Descombes, P., and U. Schibler. 1991. A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67:569-579.[CrossRef][Medline]
  20. 11
  21. Eaton, E. M., M. Hanlon, L. Bundy, and L. Sealy. 2001. Characterization of C/EBPß isoforms in normal versus neoplastic mammary epithelial cells. J. Cell Physiol. 189:91-105.[CrossRef][Medline]
  22. 12
  23. Elberg, G., J. M. Gimble, and S. Y. Tsai. 2000. Modulation of the murine peroxisome proliferator-activated receptor {gamma}2 promoter activity by CCAAT/enhancer-binding proteins. J. Biol. Chem. 275:27815-27822.[Abstract/Free Full Text]
  24. 13
  25. El-Jack, A. K., J. K. Hamm, P. F. Pilch, and S. R. Farmer. 1999. Reconstitution of insulin-sensitive glucose transport in fibroblasts requires expression of both PPAR{gamma} and C/EBP{alpha}. J. Biol. Chem. 274:7946-7951.[Abstract/Free Full Text]
  26. 14
  27. Gustafson, B., M. M. Jack, S. W. Cushman, and U. Smith. 2003. Adiponectin gene activation by thiazolidinediones requires PPAR {gamma}2, but not C/EBP{alpha}: evidence for differential regulation of the aP2 and adiponectin genes. Biochem. Biophys. Res. Commun. 308:933-939.[CrossRef][Medline]
  28. 15
  29. Hamm, J. K., A. K. el Jack, P. F. Pilch, and S. R. Farmer. 1999. Role of PPAR{gamma} in regulating adipocyte differentiation and insulin-responsive glucose uptake. Ann. N. Y. Acad. Sci. 892:134-145.[CrossRef][Medline]
  30. 16
  31. Hamm, J. K., B. H. Park, and S. R. Farmer. 2001. A role for C/EBPß in regulating peroxisome proliferator-activated receptor gamma activity during adipogenesis in 3T3-L1 preadipocytes. J. Biol. Chem. 276:18464-18471.[Abstract/Free Full Text]
  32. 17
  33. Hanlon, M., T. W. Sturgill, and L. Sealy. 2001. ERK2- and p90(Rsk2)-dependent pathways regulate the CCAAT/enhancer-binding protein-beta interaction with serum response factor. J. Biol. Chem. 276:38449-38456.[Abstract/Free Full Text]
  34. 18
  35. Kowenz-Leutz, E., and A. Leutz. 1999. A C/EBPß isoform recruits the SWI/SNF complex to activate myeloid genes. Mol. Cell 4:735-743.[CrossRef][Medline]
  36. 19
  37. Kowenz-Leutz, E., G. Twamley, S. Ansieau, and A. Leutz. 1994. Novel mechanism of C/EBPß (NF-M) transcriptional control: activation through derepression. Genes Dev. 8:2781-2791.[Abstract/Free Full Text]
  38. 20
  39. Linhart, H. G., K. Ishimura-Oka, F. DeMayo, T. Kibe, D. Repka, B. Poindexter, R. J. Bick, and G. J. Darlington. 2001. C/EBP{alpha} is required for differentiation of white, but not brown, adipose tissue. Proc. Natl. Acad. Sci. USA 98:12532-12537.[Abstract/Free Full Text]
  40. 21
  41. Moldes, M., Y. Zuo, R. F. Morrison, D. Silva, B. H. Park, J. Liu, and S. R. Farmer. 2003. Peroxisome-proliferator-activated receptor gamma suppresses Wnt/ß-catenin signalling during adipogenesis. Biochem. J. 376:607-613.[CrossRef][Medline]
  42. 22
  43. Morrison, R. F., and S. R. Farmer. 1999. Insights into the transcriptional control of adipocyte differentiation. J. Cell Biochem. 1999(Suppl. 32-33):59-67.
  44. 23
  45. Nakajima, T., S. Kinoshita, T. Sasagawa, K. Sasaki, M. Naruto, T. Kishimoto, and S. Akira. 1993. Phosphorylation at threonine-235 by a ras-dependent mitogen-activated protein kinase cascade is essential for transcription factor NF-IL6. Proc. Natl. Acad. Sci. USA 90:2207-2211.[Abstract/Free Full Text]
  46. 24
  47. Pedersen, T. A., E. Kowenz-Leutz, A. Leutz, and C. Nerlov. 2001. Cooperation between C/EBP{alpha} TBP/TFIIB and SWI/SNF recruiting domains is required for adipocyte differentiation. Genes Dev. 15:3208-3216.[Abstract/Free Full Text]
  48. 25
  49. Piwien-Pilipuk, G., O. MacDougald, and J. Schwartz. 2002. Dual regulation of phosphorylation and dephosphorylation of C/EBPß modulates its transcriptional activation and DNA binding in response to growth hormone. J. Biol. Chem. 277:44557-44565.[Abstract/Free Full Text]
  50. 26
  51. Piwien-Pilipuk, G., D. Van Mater, S. E. Ross, O. A. MacDougald, and J. Schwartz. 2001. Growth hormone regulates phosphorylation and function of CCAAT/enhancer-binding protein beta by modulating Akt and glycogen synthase kinase-3. J. Biol. Chem. 276:19664-19671.[Abstract/Free Full Text]
  52. 27
  53. Prusty, D., B. H. Park, K. E. Davis, and S. R. Farmer. 2002. Activation of MEK/ERK signaling promotes adipogenesis by enhancing PPAR{gamma} and C/EBP{alpha} gene expression during the differentiation of 3T3-L1 preadipocytes. J. Biol. Chem. 277:46226-46232.[Abstract/Free Full Text]
  54. 28
  55. Rana, B., Y. Xie, D. Mischoulon, N. L. R. Bucher, and S. R. Farmer. 1995. The DNA binding activity of C/EBP transcription factors is regulated in G1 phase of the hepatocyte cell cycle. J. Biol. Chem. 270:18123-18132.[Abstract/Free Full Text]
  56. 29
  57. Rosen, E. D., C. H. Hsu, X. Wang, S. Sakai, M. W. Freeman, F. J. Gonzalez, and B. M. Spiegelman. 2002. C/EBP{alpha} induces adipogenesis through PPAR{gamma} unified pathway. Genes Dev. 16:22-26.[Abstract/Free Full Text]
  58. 30
  59. Rosen, E. D., P. Sarraf, A. E. Troy, G. Bradwin, K. Moore, D. S. Milstone, B. M. Spiegelman, and R. M. Mortensen. 1999. PPAR{gamma} is required for the differentiation of adipose tissue in vivo and in vitro. Mol. Cell 4:611-617.[CrossRef][Medline]
  60. 31
  61. Rosen, E. D., C. J. Walkey, P. Puigserver, and B. M. Spiegelman. 2000. Transcriptional regulation of adipogenesis. Genes Dev. 14:1293-1307.[Free Full Text]
  62. 32
  63. Tang, Q. Q., T. C. Otto, and M. D. Lane. 2003. Mitotic clonal expansion: a synchronous process required for adipogenesis. Proc. Natl. Acad. Sci. USA 100:44-49.[Abstract/Free Full Text]
  64. 33
  65. Trautwein, C., C. Caelles, P. van der Geer, T. Hunter, M. Karin, and M. Chojkier. 1993. Transactivation by NF-IL6/LAP is enhanced by phosphorylation of its activation domain. Nature 364:544-547.[CrossRef][Medline]
  66. 34
  67. Trautwein, C., P. van der Geer, M. Karin, T. Hunter, and M. Chojkier. 1994. Protein kinase A and C site-specific phosphorylations of LAP (NF-IL6) modulate its binding affinity to DNA recognition elements. J. Clin. Investig. 93:2554-2561.
  68. 35
  69. Wegner, M., Z. Cao, and M. G. Rosenfeld. 1992. Calcium-regulated phosphorylation within the leucine zipper of C/EBPß. Science 256:370-373.[Abstract/Free Full Text]
  70. 36
  71. Wu, Z., N. L. R. Bucher, and S. R. Farmer. 1996. Induction of peroxisome proliferator-activated receptor gamma during conversion of 3T3 fibroblasts into adipocytes is mediated by C/EBPß, C/EBP{delta}, and glucocorticoids. Mol. Cell. Biol. 16:4128-4136.[Abstract]
  72. 37
  73. Wu, Z., Y. Xie, N. L. R. Bucher, and S. R. Farmer. 1995. Conditional ectopic expression of C/EBPß in NIH 3T3 cells induces PPAR{gamma} and stimulates adipogenesis. Genes Dev. 9:2350-2363.[Abstract/Free Full Text]
  74. 38
  75. Wu, Z., Y. Xie, R. F. Morrison, N. L. Bucher, and S. R. Farmer. 1998. PPAR{gamma} induces the insulin-dependent glucose transporter GLUT4 in the absence of C/EBP{alpha} during the conversion of 3T3 fibroblasts into adipocytes. J. Clin. Investig. 101:22-32.[Medline]
  76. 39
  77. Xiong, W., C. C. Hsieh, A. J. Kurtz, J. P. Rabek, and J. Papaconstantinou. 2001. Regulation of CCAAT/enhancer-binding protein-beta isoform synthesis by alternative translational initiation at multiple AUG start sites. Nucleic Acids Res. 29:3087-3098.[Abstract/Free Full Text]
  78. 40
  79. Yang, T. T., and C. W. Chow. 2003. Transcription cooperation by NFAT.C/EBP composite enhancer complex. J. Biol. Chem. 278:15874-15885.[Abstract/Free Full Text]
  80. 41
  81. Yeh, W. C., Z. Cao, M. Classon, and S. L. McKnight. 1995. Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins. Genes Dev. 9:168-181.[Abstract/Free Full Text]


Molecular and Cellular Biology, October 2004, p. 8671-8680, Vol. 24, No. 19
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.19.8671-8680.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Loo, L.-H., Lin, H.-J., Singh, D. K., Lyons, K. M., Altschuler, S. J., Wu, L. F. (2009). Heterogeneity in the physiological states and pharmacological responses of differentiating 3T3-L1 preadipocytes. JCB 187: 375-384 [Abstract] [Full Text]  
  • Vernochet, C., Peres, S. B., Davis, K. E., McDonald, M. E., Qiang, L., Wang, H., Scherer, P. E., Farmer, S. R. (2009). C/EBP{alpha} and the Corepressors CtBP1 and CtBP2 Regulate Repression of Select Visceral White Adipose Genes during Induction of the Brown Phenotype in White Adipocytes by Peroxisome Proliferator-Activated Receptor {gamma} Agonists. Mol. Cell. Biol. 29: 4714-4728 [Abstract] [Full Text]  
  • Gerin, I., Bommer, G. T., Lidell, M. E., Cederberg, A., Enerback, S., MacDougald, O. A. (2009). On the Role of FOX Transcription Factors in Adipocyte Differentiation and Insulin-stimulated Glucose Uptake. J. Biol. Chem. 284: 10755-10763 [Abstract] [Full Text]  
  • Marion, V., Stoetzel, C., Schlicht, D., Messaddeq, N., Koch, M., Flori, E., Danse, J. M., Mandel, J.-L., Dollfus, H. (2009). Transient ciliogenesis involving Bardet-Biedl syndrome proteins is a fundamental characteristic of adipogenic differentiation. Proc. Natl. Acad. Sci. USA 106: 1820-1825 [Abstract] [Full Text]  
  • Huang, D., Yang, C., Wang, Y., Liao, Y., Huang, K. (2009). PARP-1 suppresses adiponectin expression through poly(ADP-ribosyl)ation of PPAR{gamma} in cardiac fibroblasts. Cardiovasc Res 81: 98-107 [Abstract] [Full Text]  
  • Tonge, D., Chan, K., Zhu, N., Panjwani, A., Arno, M., Lynham, S., Ward, M., Snape, A., Pizzey, J. (2008). Enhancement of axonal regeneration by in vitro conditioning and its inhibition by cyclopentenone prostaglandins. J. Cell Sci. 121: 2565-2577 [Abstract] [Full Text]  
  • Cha, H. C., Oak, N. R., Kang, S., Tran, T.-A., Kobayashi, S., Chiang, S.-H., Tenen, D. G., MacDougald, O. A. (2008). Phosphorylation of CCAAT/Enhancer-binding Protein {alpha} Regulates GLUT4 Expression and Glucose Transport in Adipocytes. J. Biol. Chem. 283: 18002-18011 [Abstract] [Full Text]  
  • Gade, P., Roy, S. K., Li, H., Nallar, S. C., Kalvakolanu, D. V. (2008). Critical Role for Transcription Factor C/EBP-{beta} in Regulating the Expression of Death-Associated Protein Kinase 1. Mol. Cell. Biol. 28: 2528-2548 [Abstract] [Full Text]  
  • Miller, J. R., Siripurkpong, P., Hawes, J., Majdalawieh, A., Ro, H.-S., McLeod, R. S. (2008). The trans-10, cis-12 isomer of conjugated linoleic acid decreases adiponectin assembly by PPAR{gamma}-dependent and PPAR{gamma}-independent mechanisms. J. Lipid Res. 49: 550-562 [Abstract] [Full Text]  
  • Bezy, O., Vernochet, C., Gesta, S., Farmer, S. R., Kahn, C. R. (2007). TRB3 Blocks Adipocyte Differentiation through the Inhibition of C/EBP{beta} Transcriptional Activity. Mol. Cell. Biol. 27: 6818-6831 [Abstract] [Full Text]  
  • Wiper-Bergeron, N., St-Louis, C., Lee, J. M. (2007). CCAAT/Enhancer Binding Protein {beta} Abrogates Retinoic Acid-Induced Osteoblast Differentiation via Repression of Runx2 Transcription. Mol. Endocrinol. 21: 2124-2135 [Abstract] [Full Text]  
  • Chou, F.-S., Wang, P.-S., Kulp, S., Pinzone, J. J. (2007). Effects of Thiazolidinediones on Differentiation, Proliferation, and Apoptosis. Mol Cancer Res 5: 523-530 [Abstract] [Full Text]  
  • Liu, J., Martin, H., Shamay, M., Woodard, C., Tang, Q.-Q., Hayward, S. D. (2007). Kaposi's Sarcoma-Associated Herpesvirus LANA Protein Downregulates Nuclear Glycogen Synthase Kinase 3 Activity and Consequently Blocks Differentiation. J. Virol. 81: 4722-4731 [Abstract] [Full Text]  
  • Kim, S. G., Lee, S. J. (2007). PI3K, RSK, and mTOR Signal Networks for the GST Gene Regulation. Toxicol Sci 96: 206-213 [Abstract] [Full Text]  
  • Kim, K.-A., Kim, J.-H., Wang, Y., Sul, H. S. (2007). Pref-1 (Preadipocyte Factor 1) Activates the MEK/Extracellular Signal-Regulated Kinase Pathway To Inhibit Adipocyte Differentiation. Mol. Cell. Biol. 27: 2294-2308 [Abstract] [Full Text]  
  • Danek, E. I., Tcherkezian, J., Triki, I., Meriane, M., Lamarche-Vane, N. (2007). Glycogen Synthase Kinase-3 Phosphorylates CdGAP at a Consensus ERK 1 Regulatory Site. J. Biol. Chem. 282: 3624-3631 [Abstract] [Full Text]  
  • Cesena, T. I., Cardinaux, J.-R., Kwok, R., Schwartz, J. (2007). CCAAT/Enhancer-binding Protein (C/EBP) beta Is Acetylated at Multiple Lysines: ACETYLATION OF C/EBPbeta AT LYSINE 39 MODULATES ITS ABILITY TO ACTIVATE TRANSCRIPTION. J. Biol. Chem. 282: 956-967 [Abstract] [Full Text]  
  • Qiao, L., Shao, J. (2006). SIRT1 Regulates Adiponectin Gene Expression through Foxo1-C/Enhancer-binding Protein {alpha} Transcriptional Complex. J. Biol. Chem. 281: 39915-39924 [Abstract] [Full Text]  
  • Gustafson, B., Smith, U. (2006). Cytokines Promote Wnt Signaling and Inflammation and Impair the Normal Differentiation and Lipid Accumulation in 3T3-L1 Preadipocytes. J. Biol. Chem. 281: 9507-9516 [Abstract] [Full Text]  
  • Zuo, Y., Qiang, L., Farmer, S. R. (2006). Activation of CCAAT/Enhancer-binding Protein (C/EBP) {alpha} Expression by C/EBPbeta during Adipogenesis Requires a Peroxisome Proliferator-activated Receptor-{gamma}-associated Repression of HDAC1 at the C/ebp{alpha} Gene Promoter. J. Biol. Chem. 281: 7960-7967 [Abstract] [Full Text]  
  • Salma, N, Xiao, H, Imbalzano, A N (2006). Temporal recruitment of CCAAT/enhancer-binding proteins to early and late adipogenic promoters in vivo. J Mol Endocrinol 36: 139-151 [Abstract] [Full Text]  
  • Aouadi, M., Laurent, K., Prot, M., Le Marchand-Brustel, Y., Binetruy, B., Bost, F. (2006). Inhibition of p38MAPK Increases Adipogenesis From Embryonic to Adult Stages. Diabetes 55: 281-289 [Abstract] [Full Text]  
  • Qiao, L., Schaack, J., Shao, J. (2006). Suppression of Adiponectin Gene Expression by Histone Deacetylase Inhibitor Valproic Acid. Endocrinology 147: 865-874 [Abstract] [Full Text]  
  • Han, S., Ritzenthaler, J. D., Wingerd, B., Roman, J. (2005). Activation of Peroxisome Proliferator-activated Receptor {beta}/{delta} (PPAR{beta}/{delta}) Increases the Expression of Prostaglandin E2 Receptor Subtype EP4: THE ROLES OF PHOSPHATIDYLINOSITOL 3-KINASE AND CCAAT/ENHANCER-BINDING PROTEIN {beta}. J. Biol. Chem. 280: 33240-33249 [Abstract] [Full Text]  
  • Kortum, R. L., Costanzo, D. L., Haferbier, J., Schreiner, S. J., Razidlo, G. L., Wu, M.-H., Volle, D. J., Mori, T., Sakaue, H., Chaika, N. V., Chaika, O. V., Lewis, R. E. (2005). The Molecular Scaffold Kinase Suppressor of Ras 1 (KSR1) Regulates Adipogenesis. Mol. Cell. Biol. 25: 7592-7604 [Abstract] [Full Text]  
  • Qiao, L., MacLean, P. S., Schaack, J., Orlicky, D. J., Darimont, C., Pagliassotti, M., Friedman, J. E., Shao, J. (2005). C/EBP{alpha} Regulates Human Adiponectin Gene Transcription Through an Intronic Enhancer. Diabetes 54: 1744-1754 [Abstract] [Full Text]  
  • Liu, J., Farmer, S. R. (2004). Regulating the Balance between Peroxisome Proliferator-activated Receptor {gamma} and {beta}-Catenin Signaling during Adipogenesis: A GLYCOGEN SYNTHASE KINASE 3{beta} PHOSPHORYLATION-DEFECTIVE MUTANT OF {beta}-CATENIN INHIBITS EXPRESSION OF A SUBSET OF ADIPOGENIC GENES. J. Biol. Chem. 279: 45020-45027 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, B.-H.
Right arrow Articles by Farmer, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, B.-H.
Right arrow Articles by Farmer, S. R.